Automated summary: This pre miRNA sequence is 91 nucleotides long and is found in Drosophila melanogaster. Annotated by 5 databases (FlyBase, Rfam, miRBase, RefSeq, ENA). Matches 1 Rfam family (mir-975, RF03367). Drosophila melanogaster (fruit fly) microRNA dme-mir-975 precursor sequence is a product of 975 precursor RN, mir-975, mir-975 precursor RNA, dme-mir-975 precursor, mir-975 precurso, 975 microRNA precursor family, 975 microRNA precursor famil, FBgn0262228, mir-975 microRNA precursor family, 975 precursor RNA, mir-975 precursor genes. Found in the fruit fly reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
UUGAAUUUUUGAUUUUAAACACUUCCUACAUCCUGUAUGUGUUUUGCAUCCGGUACAGAUGUGGGAGUCGUUUGCACUCAGAGAUUUCACA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.