Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-1-3p URS00005942EF_7227

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Drosophila melanogaster. Annotated by 6 databases (ENA, PirBase, MirGeneDB, FlyBase, RefSeq, miRBase). Described in 14 papers. Drosophila melanogaster (fruit fly) dme-miR-1-3p sequence is a product of mir-1-RA, 1-RA, 1-R, miR-1-3p, FBgn0262455, miR-1, dme-miR-1, mir-1, dme-miR-1-3p genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGAAUGUAAAGAAGUAUGGAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 38 other species

    1. Acyrthosiphon pisum (pea aphid) api-miR-1
    2. Aedes aegypti aae-miR-1
    3. Anopheles gambiae (African malaria mosquito) aga-miR-1
    4. Apis mellifera (honey bee) ame-miR-1-3p
    5. Bactrocera dorsalis (oriental fruit fly) bdo-miR-1
    6. Blattella germanica (German cockroach) Bge-Mir-1_3p (mature (guide))
    7. Bombyx mori (domestic silkworm) bmo-miR-1a-3p
    8. Cochliomyia hominivorax mature cho-miR-1-3p
    9. Cochliomyia macellaria mature cma-miR-1-3p
    10. Culex quinquefasciatus (southern house mosquito) cqu-miR-1
    11. Daphnia pulex dpu-miR-1
    12. Dasypus novemcinctus Dan-Mir-1_3p (mature (guide))
    13. Dinoponera quadriceps dqu-miR-1a-3p
    14. Drosophila ananassae dan-miR-1
    15. Drosophila erecta der-miR-1
    16. Drosophila grimshawi dgr-miR-1
    17. Drosophila mojavensis dmo-miR-1
    18. Drosophila persimilis dpe-miR-1
    19. Drosophila pseudoobscura dps-miR-1
    20. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294467_df_nrg
    21. Drosophila sechellia dse-miR-1
    22. Drosophila simulans dsi-miR-1
    23. Drosophila virilis dvi-miR-1-3p
    24. Drosophila willistoni dwi-miR-1
    25. Drosophila yakuba dya-miR-1
    26. Heliconius melpomene (postman butterfly) hme-miR-1a
    27. Ixodes ricinus (castor bean tick) iri-miR-1-3p
    28. Ixodes scapularis (black-legged tick) isc-miR-1
    29. Manduca sexta mse-miR-1a
    30. Mus musculus Mus_musculus piRNA piR-mmu-50153474
    31. Nasonia giraulti ngi-miR-1
    32. Nasonia vitripennis nvi-miR-1
    33. Parasteatoda tepidariorum (common house spider) pte-miR-1-3p
    34. Penaeus japonicus miR-1
    35. Penaeus vannamei partial Lva-miR-1
    36. Polistes canadensis pca-miR-1-3p
    37. Tetranychus urticae (two-spotted spider mite) tur-miR-1-3p
    38. Tribolium castaneum (red flour beetle) tca-miR-1-3p
    39. Triops cancriformis tcf-miR-1