Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila grimshawi dgr-miR-1 URS00005942EF_7222

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Drosophila grimshawi. Annotated by 2 databases (miRBase, Ensembl Metazoa). Described in 1 paper. Drosophila grimshawi dgr-miR-1 sequence is a product of FBtr0292361_df_nrg gene. Found in the Drosophila grimshawi reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGAAUGUAAAGAAGUAUGGAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 39 other species

    1. Acyrthosiphon pisum api-miR-1
    2. Aedes aegypti aae-miR-1
    3. Anopheles gambiae aga-miR-1
    4. Apis mellifera ame-miR-1-3p
    5. Bactrocera dorsalis (oriental fruit fly) bdo-miR-1
    6. Blattella germanica Bge-Mir-1_3p (mature (guide))
    7. Bombyx mori (domestic silkworm) bmo-miR-1a-3p
    8. Cochliomyia hominivorax mature cho-miR-1-3p
    9. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-1-3p
    10. Culex quinquefasciatus (southern house mosquito) cqu-miR-1
    11. Daphnia pulex dpu-miR-1
    12. Dasypus novemcinctus Dan-Mir-1_3p (mature (guide))
    13. Dinoponera quadriceps dqu-miR-1a-3p
    14. Drosophila ananassae dan-miR-1
    15. Drosophila erecta der-miR-1
    16. Drosophila melanogaster dme-miR-1-3p
    17. Drosophila mojavensis dmo-miR-1
    18. Drosophila persimilis dpe-miR-1
    19. Drosophila pseudoobscura dps-miR-1
    20. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294467_df_nrg
    21. Drosophila sechellia dse-miR-1
    22. Drosophila simulans dsi-miR-1
    23. Drosophila virilis dvi-miR-1-3p
    24. Drosophila willistoni dwi-miR-1
    25. Drosophila yakuba dya-miR-1
    26. Heliconius melpomene hme-miR-1a
    27. Ixodes ricinus iri-miR-1-3p
    28. Ixodes scapularis isc-miR-1
    29. Manduca sexta mse-miR-1a
    30. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-50153474
    31. Nasonia giraulti ngi-miR-1
    32. Nasonia vitripennis nvi-miR-1
    33. Parasteatoda tepidariorum pte-miR-1-3p
    34. Penaeus japonicus miR-1
    35. Penaeus vannamei partial Lva-miR-1
    36. Polistes canadensis pca-miR-1-3p
    37. Tetranychus urticae tur-miR-1-3p
    38. Tribolium castaneum tca-miR-1-3p
    39. Triops cancriformis tcf-miR-1