Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Anopheles gambiae (African malaria mosquito) aga-miR-1 URS00005942EF_7165

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Anopheles gambiae. Annotated by 1 database (miRBase). Described in 0 papers. Found in the african malaria mosquito reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGAAUGUAAAGAAGUAUGGAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 198 other species

    1. Acyrthosiphon pisum api-miR-1
    2. Aedes aegypti aae-miR-1
    3. Apis mellifera ame-miR-1-3p
    4. Bactrocera dorsalis (oriental fruit fly) bdo-miR-1
    5. Blattella germanica (German cockroach) Bge-Mir-1_3p (mature (guide))
    6. Bombyx mori (domestic silkworm) bmo-miR-1a-3p
    7. Centruroides sculpturatus Csc-Mir-1-P18b_3p (mature (guide))
    8. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-1-3p
    9. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-1-3p
    10. Culex quinquefasciatus cqu-miR-1
    11. Daphnia magna Dma-Mir-1_3p (mature (guide))
    12. Daphnia pulex (common water flea) dpu-miR-1
    13. Dinoponera quadriceps dqu-miR-1a-3p
    14. Drosophila ananassae dan-miR-1
    15. Drosophila erecta der-miR-1
    16. Drosophila grimshawi dgr-miR-1
    17. Drosophila melanogaster (fruit fly) dme-miR-1-3p
    18. Drosophila mojavensis dmo-miR-1
    19. Drosophila persimilis dpe-miR-1
    20. Drosophila pseudoobscura dps-miR-1
    21. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294467_df_nrg
    22. Drosophila sechellia dse-miR-1
    23. Drosophila simulans dsi-miR-1
    24. Drosophila virilis dvi-miR-1-3p
    25. Drosophila willistoni dwi-miR-1
    26. Drosophila yakuba dya-miR-1
    27. Heliconius melpomene (postman butterfly) hme-miR-1a
    28. Hyalella azteca miR-1
    29. Ixodes ricinus iri-miR-1-3p
    30. Ixodes scapularis isc-miR-1
    31. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-1-P16_3p (mature (guide))
    32. Manduca sexta (tobacco hornworm) mse-miR-1a
    33. Mus musculus Mus_musculus piRNA piR-mmu-50153474
    34. Nasonia giraulti ngi-miR-1
    35. Nasonia vitripennis (jewel wasp) nvi-miR-1
    36. Parasteatoda tepidariorum (common house spider) pte-miR-1-3p
    37. Penaeus japonicus miR-1
    38. Penaeus vannamei (Pacific white shrimp) partial Lva-miR-1
    39. Polistes canadensis pca-miR-1-3p
    40. Tetranychus urticae (two-spotted spider mite) tur-miR-1-3p
    41. Tribolium castaneum tca-miR-1-3p
    42. Triops cancriformis tcf-miR-1
    Publications New