v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-1a-3p URS00005942EF_7091

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Bombyx mori. Annotated by 3 databases (RefSeq, miRBase, ENA). Bombyx mori (domestic silkworm) bmo-miR-1a-3p sequence is a product of miR-1a-3p, miR-1a, bmo-miR-1a-3p, miR-1, Mir1a, bmo-miR-1a genes. Found in the Bombyx mori reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UGGAAUGUAAAGAAGUAUGGAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 42 other species

    1. Acyrthosiphon pisum api-miR-1
    2. Aedes aegypti (yellow fever mosquito) aae-miR-1
    3. Anopheles gambiae (African malaria mosquito) aga-miR-1
    4. Apis mellifera (honey bee) ame-miR-1-3p
    5. Bactrocera dorsalis (oriental fruit fly) bdo-miR-1
    6. Blattella germanica (German cockroach) Bge-Mir-1_3p (mature (guide))
    7. Centruroides sculpturatus (bark scorpion) Csc-Mir-1-P18b_3p (mature (guide))
    8. Cochliomyia hominivorax mature cho-miR-1-3p
    9. Cochliomyia macellaria mature cma-miR-1-3p
    10. Culex quinquefasciatus (southern house mosquito) cqu-miR-1
    11. Daphnia magna Dma-Mir-1_3p (mature (guide))
    12. Daphnia pulex dpu-miR-1
    13. Dinoponera quadriceps dqu-miR-1a-3p
    14. Drosophila ananassae dan-miR-1
    15. Drosophila erecta der-miR-1
    16. Drosophila grimshawi dgr-miR-1
    17. Drosophila melanogaster dme-miR-1-3p
    18. Drosophila mojavensis dmo-miR-1
    19. Drosophila persimilis dpe-miR-1
    20. Drosophila pseudoobscura dps-miR-1
    21. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294467_df_nrg
    22. Drosophila sechellia dse-miR-1
    23. Drosophila simulans dsi-miR-1
    24. Drosophila virilis dvi-miR-1-3p
    25. Drosophila willistoni dwi-miR-1
    26. Drosophila yakuba dya-miR-1
    27. Heliconius melpomene (postman butterfly) hme-miR-1a
    28. Hyalella azteca miR-1
    29. Ixodes ricinus iri-miR-1-3p
    30. Ixodes scapularis (black-legged tick) isc-miR-1
    31. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-1-P16_3p (mature (guide))
    32. Manduca sexta mse-miR-1a
    33. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-50153474
    34. Nasonia giraulti ngi-miR-1
    35. Nasonia vitripennis (jewel wasp) nvi-miR-1
    36. Parasteatoda tepidariorum (common house spider) pte-miR-1-3p
    37. Penaeus japonicus miR-1
    38. Penaeus vannamei partial Lva-miR-1
    39. Polistes canadensis pca-miR-1-3p
    40. Tetranychus urticae tur-miR-1-3p
    41. Tribolium castaneum tca-miR-1-3p
    42. Triops cancriformis tcf-miR-1
     Publications