Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Petromyzon marinus (sea lamprey) pma-miR-27b-3p URS000059311D_7757

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Petromyzon marinus. Annotated by 2 databases (miRBase, MirGeneDB). Described in 1 paper. Found in the sea lamprey reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUCACAGUGGCUAAGUUCUGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 332 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-27-P2_3p (mature (guide))
    2. Anolis carolinensis (green anole) Aca-Mir-27-P2_3p (mature (guide))
    3. Bos taurus bta-miR-27b
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-27b
    5. Canis lupus familiaris (dog) cfa-miR-27b
    6. Capra hircus chi-miR-27b-3p
    7. Cavia porcellus (domestic guinea pig) cpo-miR-27b-3p
    8. Cervus elaphus (red deer) cel-miR-27b
    9. Chiloscyllium plagiosum microRNA cpl-miR-27b
    10. Chrysemys picta bellii Cpi-Mir-27-P2_3p (mature (guide))
    11. Chrysemys picta cpi-miR-27b-3p
    12. Columba livia cli-miR-27b-3p
    13. Cricetulus griseus cgr-miR-27b-3p
    14. Danio rerio (zebrafish) Dre-Mir-27-P2b_3p (mature (guide))
    15. Dasypus novemcinctus dno-miR-27b-3p
    16. Echinops telfairi Ete-Mir-27-P2_3p (mature (guide))
    17. Equus caballus (horse) eca-miR-27b
    18. Gadus morhua (Atlantic cod) Gmo-Mir-27-P2b_3p (mature (guide))
    19. Gallus gallus (chicken) gga-miR-27b-3p
    20. Gekko japonicus Gja-Mir-27-P2_3p (mature (guide))
    21. Gorilla gorilla (western gorilla) ggo-miR-27b
    22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-27b
    23. Homo sapiens hsa-miR-27b-3p
    24. Ictalurus punctatus ipu-miR-27b
    25. Latimeria chalumnae (coelacanth) Lch-Mir-27-P1_3p (mature (guide))
    26. Lepisosteus oculatus (spotted gar) Loc-Mir-27-P2_3p (mature (guide))
    27. Macaca mulatta (Rhesus monkey) mml-miR-27b-3p
    28. Maylandia zebra mze-miR-27b
    29. Microcaecilia unicolor Mun-Mir-27-P2_3p (mature (guide))
    30. Microcebus murinus (gray mouse lemur) mmr-miR-27b
    31. Monodelphis domestica (gray short-tailed opossum) mdo-miR-27b-3p
    32. Monopterus albus (swamp eel) Mal-Mir-27-P2b_3p (mature (guide))
    33. Mus musculus mmu-miR-27b-3p
    34. Neolamprologus brichardi nbr-miR-27b
    35. Oreochromis niloticus oni-miR-27b
    36. Ornithorhynchus anatinus (platypus) oan-miR-27b-3p
    37. Oryctolagus cuniculus ocu-miR-27b-3p
    38. Ovis aries miscellaneous RNA
    39. Pan paniscus ppa-miR-27b
    40. Pan troglodytes (chimpanzee) ptr-miR-27b
    41. Pongo pygmaeus (Bornean orangutan) ppy-miR-27b
    42. Pteropus alecto (black flying fox) pal-miR-27b-3p
    43. Pundamilia nyererei pny-miR-27b
    44. Python bivittatus pbv-miR-27b-3p
    45. Rattus norvegicus rno-miR-27b-3p
    46. Saimiri boliviensis boliviensis sbo-miR-27b
    47. Salmo salar ssa-miR-27b-3p
    48. Sarcophilus harrisii sha-miR-27b
    49. Sphenodon punctatus (tuatara) Spt-Mir-27-P2_3p (mature (guide))
    50. Sus scrofa (pig) ssc-miR-27b-3p
    51. Taeniopygia guttata (zebra finch) tgu-miR-27-3p
    52. Tetraodon nigroviridis Tni-Mir-27-P2b_3p (mature (guide))
    53. Tupaia chinensis (Chinese tree shrew) tch-miR-27b-3p
    54. Tursiops truncatus (common bottlenose dolphin) miR-27b
    55. Xenopus laevis Xla-Mir-27-P2c_3p (mature (guide))
    56. Xenopus tropicalis xtr-miR-27b