Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gekko japonicus Gja-Mir-27-P2_3p (mature (guide)) URS000059311D_146911

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Gekko japonicus. Annotated by 1 database (MirGeneDB).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUCACAGUGGCUAAGUUCUGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 56 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-27-P2_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-27-P2_3p (mature (guide))
    3. Bos taurus (cattle) bta-miR-27b
    4. Callithrix jacchus cja-miR-27b
    5. Canis lupus familiaris (dog) cfa-miR-27b
    6. Capra hircus chi-miR-27b-3p
    7. Cavia porcellus (domestic guinea pig) cpo-miR-27b-3p
    8. Cervus elaphus cel-miR-27b
    9. Chiloscyllium plagiosum microRNA cpl-miR-27b
    10. Chrysemys picta bellii Cpi-Mir-27-P2_3p (mature (guide))
    11. Chrysemys picta (Painted turtle) cpi-miR-27b-3p
    12. Columba livia (rock pigeon) cli-miR-27b-3p
    13. Cricetulus griseus cgr-miR-27b-3p
    14. Danio rerio Dre-Mir-27-P2b_3p (mature (guide))
    15. Dasypus novemcinctus dno-miR-27b-3p
    16. Echinops telfairi Ete-Mir-27-P2_3p (mature (guide))
    17. Equus caballus eca-miR-27b
    18. Gadus morhua Gmo-Mir-27-P2b_3p (mature (guide))
    19. Gallus gallus gga-miR-27b-3p
    20. Gorilla gorilla ggo-miR-27b
    21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-27b
    22. Homo sapiens (human) hsa-miR-27b-3p
    23. Ictalurus punctatus (channel catfish) ipu-miR-27b
    24. Latimeria chalumnae (coelacanth) Lch-Mir-27-P1_3p (mature (guide))
    25. Lepisosteus oculatus Loc-Mir-27-P2_3p (mature (guide))
    26. Macaca mulatta (Rhesus monkey) mml-miR-27b-3p
    27. Maylandia zebra mze-miR-27b
    28. Microcaecilia unicolor Mun-Mir-27-P2_3p (mature (guide))
    29. Microcebus murinus mmr-miR-27b
    30. Monodelphis domestica mdo-miR-27b-3p
    31. Monopterus albus Mal-Mir-27-P2b_3p (mature (guide))
    32. Mus musculus (house mouse) mmu-miR-27b-3p
    33. Neolamprologus brichardi nbr-miR-27b
    34. Oreochromis niloticus (Nile tilapia) oni-miR-27b
    35. Ornithorhynchus anatinus oan-miR-27b-3p
    36. Oryctolagus cuniculus ocu-miR-27b-3p
    37. Ovis aries miscellaneous RNA
    38. Pan paniscus (pygmy chimpanzee) ppa-miR-27b
    39. Pan troglodytes ptr-miR-27b
    40. Petromyzon marinus pma-miR-27b-3p
    41. Pongo pygmaeus (Bornean orangutan) ppy-miR-27b
    42. Pteropus alecto pal-miR-27b-3p
    43. Pundamilia nyererei pny-miR-27b
    44. Python bivittatus (Burmese python) pbv-miR-27b-3p
    45. Rattus norvegicus rno-miR-27b-3p
    46. Saimiri boliviensis boliviensis sbo-miR-27b
    47. Salmo salar (Atlantic salmon) ssa-miR-27b-3p
    48. Sarcophilus harrisii (Tasmanian devil) sha-miR-27b
    49. Sphenodon punctatus (tuatara) Spt-Mir-27-P2_3p (mature (guide))
    50. Sus scrofa (pig) ssc-miR-27b-3p
    51. Taeniopygia guttata (zebra finch) tgu-miR-27-3p
    52. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-27-P2b_3p (mature (guide))
    53. Tupaia chinensis tch-miR-27b-3p
    54. Tursiops truncatus (common bottlenose dolphin) miR-27b
    55. Xenopus laevis Xla-Mir-27-P2c_3p (mature (guide))
    56. Xenopus tropicalis (tropical clawed frog) xtr-miR-27b