Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) mdo-miR-27b-3p URS000059311D_13616

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Monodelphis domestica. Annotated by 4 databases (MirGeneDB, miRBase, ENA, RefSeq). Monodelphis domestica (gray short-tailed opossum) mdo-miR-27b-3p sequence is a product of mdo-miR-27b-3p, mdo-miR-27b, miR-27b, miR-27, miR-27b-3p, MIR27B genes. Found in the gray short-tailed opossum reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUCACAGUGGCUAAGUUCUGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 56 other species

    1. Alligator mississippiensis Ami-Mir-27-P2_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-27-P2_3p (mature (guide))
    3. Bos taurus (cattle) bta-miR-27b
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-27b
    5. Canis lupus familiaris (dog) cfa-miR-27b
    6. Capra hircus (goat) chi-miR-27b-3p
    7. Cavia porcellus (domestic guinea pig) cpo-miR-27b-3p
    8. Cervus elaphus cel-miR-27b
    9. Chiloscyllium plagiosum microRNA cpl-miR-27b
    10. Chrysemys picta bellii Cpi-Mir-27-P2_3p (mature (guide))
    11. Chrysemys picta cpi-miR-27b-3p
    12. Columba livia cli-miR-27b-3p
    13. Cricetulus griseus cgr-miR-27b-3p
    14. Danio rerio Dre-Mir-27-P2b_3p (mature (guide))
    15. Dasypus novemcinctus dno-miR-27b-3p
    16. Echinops telfairi Ete-Mir-27-P2_3p (mature (guide))
    17. Equus caballus (horse) eca-miR-27b
    18. Gadus morhua Gmo-Mir-27-P2b_3p (mature (guide))
    19. Gallus gallus gga-miR-27b-3p
    20. Gekko japonicus Gja-Mir-27-P2_3p (mature (guide))
    21. Gorilla gorilla ggo-miR-27b
    22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-27b
    23. Homo sapiens (human) hsa-miR-27b-3p
    24. Ictalurus punctatus (channel catfish) ipu-miR-27b
    25. Latimeria chalumnae (coelacanth) Lch-Mir-27-P1_3p (mature (guide))
    26. Lepisosteus oculatus Loc-Mir-27-P2_3p (mature (guide))
    27. Macaca mulatta mml-miR-27b-3p
    28. Maylandia zebra mze-miR-27b
    29. Microcaecilia unicolor Mun-Mir-27-P2_3p (mature (guide))
    30. Microcebus murinus mmr-miR-27b
    31. Monopterus albus (swamp eel) Mal-Mir-27-P2b_3p (mature (guide))
    32. Mus musculus (house mouse) mmu-miR-27b-3p
    33. Neolamprologus brichardi nbr-miR-27b
    34. Oreochromis niloticus (Nile tilapia) oni-miR-27b
    35. Ornithorhynchus anatinus (platypus) oan-miR-27b-3p
    36. Oryctolagus cuniculus ocu-miR-27b-3p
    37. Ovis aries (sheep) miscellaneous RNA
    38. Pan paniscus ppa-miR-27b
    39. Pan troglodytes ptr-miR-27b
    40. Petromyzon marinus (sea lamprey) pma-miR-27b-3p
    41. Pongo pygmaeus ppy-miR-27b
    42. Pteropus alecto (black flying fox) pal-miR-27b-3p
    43. Pundamilia nyererei pny-miR-27b
    44. Python bivittatus (Burmese python) pbv-miR-27b-3p
    45. Rattus norvegicus (Norway rat) rno-miR-27b-3p
    46. Saimiri boliviensis boliviensis sbo-miR-27b
    47. Salmo salar (Atlantic salmon) ssa-miR-27b-3p
    48. Sarcophilus harrisii (Tasmanian devil) sha-miR-27b
    49. Sphenodon punctatus (tuatara) Spt-Mir-27-P2_3p (mature (guide))
    50. Sus scrofa (pig) ssc-miR-27b-3p
    51. Taeniopygia guttata (zebra finch) tgu-miR-27-3p
    52. Tetraodon nigroviridis Tni-Mir-27-P2b_3p (mature (guide))
    53. Tupaia chinensis (Chinese tree shrew) tch-miR-27b-3p
    54. Tursiops truncatus (common bottlenose dolphin) miR-27b
    55. Xenopus laevis Xla-Mir-27-P2c_3p (mature (guide))
    56. Xenopus tropicalis (tropical clawed frog) xtr-miR-27b
    Publications New