Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) mdo-miR-27b-3p URS000059311D_13616

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Monodelphis domestica. Annotated by 4 databases (ENA, MirGeneDB, RefSeq, miRBase). Described in 6 papers. Monodelphis domestica (gray short-tailed opossum) mdo-miR-27b-3p sequence is a product of miR-27, MIR27B, mdo-miR-27b-3p, miR-27b-3p, mdo-miR-27b, miR-27b genes. Found in the gray short-tailed opossum reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUCACAGUGGCUAAGUUCUGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 77 other species

    1. Alligator mississippiensis Ami-Mir-27-P2_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-27-P2_3p (mature (guide))
    3. Bos taurus (cattle) bta-miR-27b
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-27b
    5. Canis lupus familiaris (dog) cfa-miR-27b
    6. Capra hircus chi-miR-27b-3p
    7. Cavia porcellus cpo-miR-27b-3p
    8. Cervus elaphus (red deer) cel-miR-27b
    9. Chiloscyllium plagiosum microRNA cpl-miR-27b
    10. Chrysemys picta bellii Cpi-Mir-27-P2_3p (mature (guide))
    11. Chrysemys picta cpi-miR-27b-3p
    12. Columba livia cli-miR-27b-3p
    13. Cricetulus griseus (Chinese hamster) cgr-miR-27b-3p
    14. Danio rerio Dre-Mir-27-P2b_3p (mature (guide))
    15. Dasypus novemcinctus (nine-banded armadillo) dno-miR-27b-3p
    16. Echinops telfairi Ete-Mir-27-P2_3p (mature (guide))
    17. Equus caballus eca-miR-27b
    18. Gallus gallus (chicken) gga-miR-27b-3p
    19. Gorilla gorilla (western gorilla) ggo-miR-27b
    20. Haplochromis burtoni abu-miR-27b
    21. Homo sapiens (human) hsa-miR-27b-3p
    22. Ictalurus punctatus ipu-miR-27b
    23. Macaca mulatta mml-miR-27b-3p
    24. Maylandia zebra (zebra mbuna) mze-miR-27b
    25. Microcebus murinus (gray mouse lemur) mmr-miR-27b
    26. Mus musculus mmu-miR-27b-3p
    27. Neolamprologus brichardi nbr-miR-27b
    28. Oreochromis niloticus (Nile tilapia) oni-miR-27b
    29. Ornithorhynchus anatinus oan-miR-27b-3p
    30. Oryctolagus cuniculus ocu-miR-27b-3p
    31. Ovis aries (sheep) miscellaneous RNA
    32. Pan paniscus ppa-miR-27b
    33. Pan troglodytes (chimpanzee) ptr-miR-27b
    34. Petromyzon marinus (sea lamprey) pma-miR-27b-3p
    35. Pongo pygmaeus ppy-miR-27b
    36. Pteropus alecto (black flying fox) pal-miR-27b-3p
    37. Pundamilia nyererei pny-miR-27b
    38. Python bivittatus pbv-miR-27b-3p
    39. Rattus norvegicus rno-miR-27b-3p
    40. Saimiri boliviensis boliviensis sbo-miR-27b
    41. Salmo salar ssa-miR-27b-3p
    42. Sarcophilus harrisii (Tasmanian devil) sha-miR-27b
    43. Sus scrofa ssc-miR-27b-3p
    44. Taeniopygia guttata (zebra finch) tgu-miR-27-3p
    45. Tupaia chinensis (Chinese tree shrew) tch-miR-27b-3p
    46. Tursiops truncatus miR-27b
    47. Xenopus laevis xla-miR-27b
    48. Xenopus tropicalis xtr-miR-27b