Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-24-3p URS000059273E_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (ENA, IntAct, MalaCards, GeneCards, MirGeneDB, PSICQUIC, RefSeq, miRBase, LncBase, TarBase). Homo sapiens (human) hsa-miR-24-3p sequence is a product of miR-24-3p, hsa-miR-24, MIR24-1, MIR24-2, hsa-miR-24-3p, miR-24, 24 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-Cys, 14-3-3GAMMA, 14-3-3γ, 182-FIP, 19A, 1A1-3B, 2A9, 3D3, 4EHP, 4F2.

Interactions 31

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-24-3p interacts with:

Interaction id Participant Synonyms
EBI-25470093 intact:EBI-25470096 EBI-25470096 ENST00000340107 mrna_fgfr3
EBI-26353029 intact:EBI-26353039 EBI-26353039 ENST00000268182 mrna_iqgap1
EBI-26353034 intact:EBI-26353073 EBI-26353073 ENST00000005257 mrna_rala
URS000059273E_9606-0 O96013 O96013
URS000059273E_9606-1 O96013 O96013
URS000059273E_9606-15 O96013 O96013
URS000059273E_9606-2 P01579 P01579
URS000059273E_9606-16 P01579 P01579
URS000059273E_9606-3 P15538 P15538
URS000059273E_9606-17 P15538 P15538
URS000059273E_9606-4 P16104 P16104
URS000059273E_9606-18 P16104 P16104
URS000059273E_9606-5 P19099 P19099
URS000059273E_9606-19 P19099 P19099
URS000059273E_9606-20 P20936 P20936
URS000059273E_9606-6 P20936 P20936
URS000059273E_9606-8 P23769 P23769
URS000059273E_9606-21 P23769 P23769
URS000059273E_9606-7 P23769 P23769
URS000059273E_9606-9 P29474 P29474
URS000059273E_9606-22 P29474 P29474
URS000059273E_9606-10 P50539 P50539
URS000059273E_9606-23 P50539 P50539
URS000059273E_9606-11 Q14524 Q14524
URS000059273E_9606-24 Q14524 Q14524
URS000059273E_9606-25 Q16539 Q16539
URS000059273E_9606-12 Q16539 Q16539
URS000059273E_9606-13 Q92542 Q92542
URS000059273E_9606-26 Q92542 Q92542
URS000059273E_9606-27 Q9HBE1 Q9HBE1
URS000059273E_9606-14 Q9HBE1 Q9HBE1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGGCUCAGUUCAGCAGGAACAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 50 other species

    1. Alligator mississippiensis (American alligator) ami-miR-24-3p
    2. Anolis carolinensis (green anole) aca-miR-24-3p
    3. Bos taurus bta-miR-24-3p
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-24
    5. Callorhinchus milii (elephant shark) Cmi-Mir-24-P2_3p (mature (guide))
    6. Canis lupus familiaris (dog) Cfa-Mir-24-P2_3p (mature (guide))
    7. Capra hircus miR-24
    8. Cavia porcellus (domestic guinea pig) cpo-miR-24-3p
    9. Chrysemys picta bellii Cpi-Mir-24-P2_3p (mature (guide))
    10. Cyprinus carpio ccr-miR-24
    11. Danio rerio (zebrafish) dre-miR-24
    12. Dasypus novemcinctus dno-miR-24a-3p
    13. Echinops telfairi Ete-Mir-24-P2_3p (mature (guide))
    14. Eptatretus burgeri Ebu-Mir-24-P5_3p (mature (guide))
    15. Equus caballus (horse) eca-miR-24
    16. Gadus morhua (Atlantic cod) Gmo-Mir-24-P2b_3p (mature (guide))
    17. Gallus gallus (chicken) gga-miR-24-3p
    18. Gorilla gorilla (western gorilla) ggo-miR-24
    19. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-24b-3p
    20. Latimeria chalumnae (coelacanth) Lch-Mir-24-P2_3p (mature (guide))
    21. Lepisosteus oculatus (spotted gar) Loc-Mir-24-P2_3p (mature (guide))
    22. Macaca mulatta (Rhesus monkey) mml-miR-24-3p
    23. Macaca nemestrina (pig-tailed macaque) mne-miR-24-3p
    24. Microcaecilia unicolor Mun-Mir-24-P3b_3p (mature (guide))
    25. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-24-P2_3p (mature (guide))
    26. Mus musculus mmu-miR-24-3p
    27. Neolamprologus brichardi nbr-miR-24a
    28. Oreochromis niloticus oni-miR-24a
    29. Ornithorhynchus anatinus (platypus) oan-miR-24-3p
    30. Oryctolagus cuniculus ocu-miR-24-3p
    31. Oryzias latipes ola-miR-24a
    32. Ovis aries miscellaneous RNA
    33. Pan paniscus ppa-miR-24-3p
    34. Pan troglodytes (chimpanzee) ptr-miR-24
    35. Petromyzon marinus (sea lamprey) pma-miR-24
    36. Pongo pygmaeus (Bornean orangutan) ppy-miR-24-3p
    37. Pundamilia nyererei pny-miR-24a
    38. Python bivittatus pbv-miR-24-3p
    39. Rattus norvegicus rno-miR-24-3p
    40. Sarcophilus harrisii Sha-Mir-24-P2_3p (mature (guide))
    41. Scyliorhinus torazame (cloudy catshark) Sto-Mir-24-P1_3p (mature (guide))
    42. Sphenodon punctatus (tuatara) Spt-Mir-24-P2_3p (mature (guide))
    43. Sus scrofa (pig) ssc-miR-24-3p
    44. Taeniopygia guttata (zebra finch) tgu-miR-24-3p
    45. Takifugu rubripes fru-miR-24-3p
    46. Tetraodon nigroviridis tni-miR-24
    47. Tor tambroides miR-24
    48. Tursiops truncatus (common bottlenose dolphin) miR-24-3p
    49. Xenopus laevis xla-miR-24a-3p
    50. Xenopus tropicalis xtr-miR-24a-3p
    Publications New