Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-24 URS000059273E_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 4 databases (ENA, MirGeneDB, RefSeq, miRBase). Described in 12 papers. Danio rerio (zebrafish) dre-miR-24 sequence is a product of dre-miR-24, mir24-1, mir24-4, miR-24, mir24-3, mir24-2 genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGCUCAGUUCAGCAGGAACAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 105 other species

    1. Alligator mississippiensis ami-miR-24-3p
    2. Anolis carolinensis aca-miR-24-3p
    3. Bos taurus (cattle) bta-miR-24-3p
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-24
    5. Canis lupus familiaris (dog) Cfa-Mir-24-P1_3p (mature (guide))
    6. Capra hircus miR-24
    7. Cavia porcellus cpo-miR-24-3p
    8. Chrysemys picta bellii Cpi-Mir-24-P1_3p (mature (guide))
    9. Cyprinus carpio (common carp) ccr-miR-24
    10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-24a-3p
    11. Echinops telfairi Ete-Mir-24-P1_3p (mature (guide))
    12. Equus caballus eca-miR-24
    13. Gallus gallus (chicken) gga-miR-24-3p
    14. Gorilla gorilla (western gorilla) ggo-miR-24
    15. Haplochromis burtoni abu-miR-24b-3p
    16. Homo sapiens (human) hsa-miR-24-3p
    17. Macaca mulatta mml-miR-24-3p
    18. Macaca nemestrina mne-miR-24-3p
    19. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-24-P1_3p (mature (guide))
    20. Mus musculus mmu-miR-24-3p
    21. Neolamprologus brichardi nbr-miR-24a
    22. Oreochromis niloticus (Nile tilapia) oni-miR-24a
    23. Ornithorhynchus anatinus oan-miR-24-3p
    24. Oryctolagus cuniculus ocu-miR-24-3p
    25. Oryzias latipes ola-miR-24a
    26. Ovis aries (sheep) miscellaneous RNA
    27. Pan paniscus ppa-miR-24-3p
    28. Pan troglodytes (chimpanzee) ptr-miR-24
    29. Petromyzon marinus (sea lamprey) pma-miR-24
    30. Pongo pygmaeus ppy-miR-24-3p
    31. Pundamilia nyererei pny-miR-24a
    32. Python bivittatus pbv-miR-24-3p
    33. Rattus norvegicus rno-miR-24-3p
    34. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-24-P1_3p (mature (guide))
    35. Scyliorhinus torazame (cloudy catshark) Sto-Mir-24-P1_3p (mature (guide))
    36. Sus scrofa ssc-miR-24-3p
    37. Taeniopygia guttata (zebra finch) tgu-miR-24-3p
    38. Takifugu rubripes fru-miR-24-3p
    39. Tetraodon nigroviridis tni-miR-24
    40. Tor tambroides miR-24
    41. Tursiops truncatus miR-24-3p
    42. Xenopus laevis xla-miR-24a-3p
    43. Xenopus tropicalis xtr-miR-24a-3p