Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-24-3p URS000059273E_10090

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCUCAGUUCAGCAGGAACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 51 other species

  1. Alligator mississippiensis (American alligator) ami-miR-24-3p
  2. Anolis carolinensis (green anole) aca-miR-24-3p
  3. Bos taurus (cattle) bta-miR-24-3p
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-24
  5. Callorhinchus milii Cmi-Mir-24-P2_3p (mature (guide))
  6. Canis lupus familiaris (dog) Cfa-Mir-24-P2_3p (mature (guide))
  7. Capra hircus (goat) miR-24
  8. Cavia porcellus cpo-miR-24-3p
  9. Chrysemys picta bellii Cpi-Mir-24-P2_3p (mature (guide))
  10. Cyprinus carpio (common carp) ccr-miR-24
  11. Danio rerio (zebrafish) dre-miR-24
  12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-24a-3p
  13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-24-P2_3p (mature (guide))
  14. Eptatretus burgeri (inshore hagfish) Ebu-Mir-24-P5_3p (mature (guide))
  15. Equus caballus (horse) eca-miR-24
  16. Gadus morhua Gmo-Mir-24-P2b_3p (mature (guide))
  17. Gallus gallus gga-miR-24-3p
  18. Gorilla gorilla gorilla ggo-miR-24 (MIR24)
  19. Gorilla gorilla ggo-miR-24
  20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-24b-3p
  21. Homo sapiens (human) hsa-miR-24-3p
  22. Latimeria chalumnae Lch-Mir-24-P2_3p (mature (guide))
  23. Lepisosteus oculatus (spotted gar) Loc-Mir-24-P2_3p (mature (guide))
  24. Macaca mulatta (Rhesus monkey) mml-miR-24-3p
  25. Macaca nemestrina mne-miR-24-3p
  26. Microcaecilia unicolor Mun-Mir-24-P3b_3p (mature (guide))
  27. Monodelphis domestica Mdo-Mir-24-P2_3p (mature (guide))
  28. Neolamprologus brichardi (lyretail cichlid) nbr-miR-24a
  29. Oreochromis niloticus oni-miR-24a
  30. Ornithorhynchus anatinus (platypus) oan-miR-24-3p
  31. Oryctolagus cuniculus (rabbit) ocu-miR-24-3p
  32. Oryzias latipes (Japanese medaka) ola-miR-24a
  33. Ovis aries (sheep) miscellaneous RNA
  34. Pan paniscus (pygmy chimpanzee) ppa-miR-24-3p
  35. Pan troglodytes ptr-miR-24
  36. Petromyzon marinus pma-miR-24
  37. Pongo pygmaeus ppy-miR-24-3p
  38. Pundamilia nyererei pny-miR-24a
  39. Python bivittatus (Burmese python) pbv-miR-24-3p
  40. Rattus norvegicus rno-miR-24-3p
  41. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-24-P2_3p (mature (guide))
  42. Scyliorhinus torazame (cloudy catshark) Sto-Mir-24-P1_3p (mature (guide))
  43. Sphenodon punctatus (tuatara) Spt-Mir-24-P2_3p (mature (guide))
  44. Sus scrofa (pig) ssc-miR-24-3p
  45. Taeniopygia guttata tgu-miR-24-3p
  46. Takifugu rubripes fru-miR-24-3p
  47. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-24
  48. Tor tambroides miR-24
  49. Tursiops truncatus (common bottlenose dolphin) miR-24-3p
  50. Xenopus laevis (African clawed frog) xla-miR-24a-3p
  51. Xenopus tropicalis (tropical clawed frog) xtr-miR-24a-3p
Publications