Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Arabidopsis halleri subsp. gemmifera tRNA-Glu for anticodon UUC secondary structure diagram

Arabidopsis halleri subsp. gemmifera tRNA-Glu for anticodon UUC URS0000591E4F_63677

Automated summary: This tRNA sequence is 72 nucleotides long and is found in Arabidopsis halleri subsp. gemmifera. Annotated by 1 database (Ensembl Plants). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Arabidopsis halleri subsp. gemmifera tRNA-Glu for anticodon UUC sequence is a product of ENSRNA050027993, ENSRNA050028073, ENSRNA050027870 genes. Found in the Arabidopsis halleri subsp. gemmifera reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCCGAUGUCGUCCAGCGGUUAGGAUAUCUGGCUUUCACCCAGGAGACCCGGGUUCGAUUCCCGGCAUCGGAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 16 other species

    1. Arabidopsis lyrata subsp. lyrata tRNA-Glu for anticodon UUC
    2. Arabidopsis suecica tRNA-Glu
    3. Arabidopsis thaliana pre-tRNA
    4. Arabidopsis thaliana x Arabidopsis arenosa tRNA-Glu
    5. Arabis alpina tRNA
    6. Brassica napus tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 21)
    7. Brassica oleracea var. oleracea (wild cabbage) tRNA-Glu for anticodon UUC
    8. Brassica rapa tRNA-Glu for anticodon UUC
    9. Brassica rapa subsp. pekinensis tRNA
    10. Capsella rubella tRNA
    11. Eutrema salsugineum tRNA
    2D structure New