v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-7-5p URS0000591950_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 6 databases (MalaCards, GeneCards, IntAct, TarBase, ENA, LncBase). Homo sapiens (human) hsa-miR-7-5p sequence is a product of hsa-miR-7-5p, miR-7-5p, hsa-miR-7, miR-7, MIR7-2, MIR7-3, MIR7-1 genes. Found in the Homo sapiens reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-8D, 1-8U, 12CC4, 12S-LOX, 14-3-3GAMMA, 14-3-3γ, 16.3A5, 16E1BP, 1700010H15RiK, 182-FIP.

Interactions 18

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-7-5p interacts with:

Interaction id Participant Synonyms
EBI-20561512 intact:EBI-20559808 EBI-20559808 ENST00000406246.7 mrna_rela
EBI-20561889 intact:EBI-20559808 EBI-20559808 ENST00000406246.7 mrna_rela
EBI-20565090 intact:EBI-20565067 EBI-20565067 ENST00000340356.8 mrna_sox18
EBI-20738508 intact:EBI-20738499 EBI-20738499 ENST00000357736.8 mrna_mafg
EBI-20768296 intact:EBI-20738906 EBI-20738906 ENST00000377966.3 mrna_reck
EBI-20768391 intact:EBI-20740118 EBI-20740118 ENST00000374672.4 mrna_klf4
EBI-22115127 intact:EBI-20740126 EBI-20740126 ENST00000640368 mrna_pax6
EBI-20769378 intact:EBI-20740126 EBI-20740126 ENST00000640368 mrna_pax6
EBI-20769458 intact:EBI-20740256 EBI-20740256 ENST00000379400.7 rassf2
EBI-20769657 intact:EBI-20740326 EBI-20740326 ENST00000534300.5 mrna_ambra1
URS0000591950_9606-0 O43474 O43474
URS0000591950_9606-4 O43474 O43474
URS0000591950_9606-5 P06213 P06213
URS0000591950_9606-1 P06213 P06213
URS0000591950_9606-6 P14735 P14735
URS0000591950_9606-2 P14735 P14735
URS0000591950_9606-3 Q9Y4H2 Q9Y4H2
URS0000591950_9606-7 Q9Y4H2 Q9Y4H2

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UGGAAGACUAGUGAUUUUGUUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 61 other species

    1. Aedes aegypti (yellow fever mosquito) aae-miR-7
    2. Alligator mississippiensis (American alligator) ami-miR-7a-5p
    3. Anolis carolinensis aca-miR-7-5p
    4. Anopheles gambiae (African malaria mosquito) aga-miR-7
    5. Apis mellifera (honey bee) ame-miR-7-5p
    6. Bombyx mori (domestic silkworm) bmo-miR-7-5p
    7. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-7-5p
    8. Branchiostoma floridae (Florida lancelet) bfl-miR-7
    9. Branchiostoma lanceolatum (amphioxus) Bla-Mir-7_5p (mature (guide))
    10. Callorhinchus milii (elephant shark) Cmi-Mir-7-P1_5p (mature (guide))
    11. Canis lupus familiaris (dog) cfa-miR-7
    12. Centruroides sculpturatus (bark scorpion) Csc-Mir-7-P14_5p (mature (guide))
    13. Chrysemys picta bellii Cpi-Mir-7-P1_5p (mature (guide))
    14. Ciona savignyi csa-miR-7
    15. Cricetulus griseus cgr-miR-7a
    16. Culex quinquefasciatus (southern house mosquito) cqu-miR-7
    17. Danio rerio dre-miR-7a
    18. Daphnia pulex dpu-miR-7
    19. Drosophila ananassae dan-miR-7
    20. Drosophila erecta der-miR-7
    21. Drosophila grimshawi dgr-miR-7
    22. Drosophila melanogaster dme-miR-7-5p
    23. Drosophila mojavensis dmo-miR-7
    24. Drosophila persimilis dpe-miR-7
    25. Drosophila pseudoobscura dps-miR-7
    26. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294419_df_nrg
    27. Drosophila sechellia dse-miR-7
    28. Drosophila simulans dsi-miR-7
    29. Drosophila willistoni dwi-miR-7
    30. Drosophila yakuba dya-miR-7
    31. Equus caballus eca-miR-7
    32. Gadus morhua gmo-miR-7c-5p
    33. Gallus gallus Gallus_gallus piRNA piR-gga-291
    34. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-7
    35. Ictalurus punctatus (channel catfish) ipu-miR-7a
    36. Ixodes scapularis (black-legged tick) isc-miR-7
    37. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-7_5p (mature (guide))
    38. Lytechinus variegatus lva-miR-7-5p
    39. Macaca mulatta (Rhesus monkey) mml-miR-7
    40. Maylandia zebra mze-miR-7b
    41. Monopterus albus Mal-Mir-7-P4a_5p (mature (guide))
    42. Mus musculus (house mouse) mmu-miR-7a-5p
    43. Nasonia longicornis nlo-miR-7
    44. Nasonia vitripennis (jewel wasp) nvi-miR-7
    45. Neolamprologus brichardi nbr-miR-7
    46. Oreochromis niloticus (Nile tilapia) oni-miR-7
    47. Ornithorhynchus anatinus oan-miR-7-5p
    48. Pan troglodytes ptr-miR-7
    49. Patiria miniata pmi-miR-7-5p
    50. Petromyzon marinus pma-miR-7a-5p
    51. Pundamilia nyererei pny-miR-7
    52. Rattus norvegicus rno-miR-7a-5p
    53. Saccoglossus kowalevskii sko-miR-7-5p
    54. Salmo salar (Atlantic salmon) ssa-miR-7a-5p
    55. Strongylocentrotus purpuratus spu-miR-7
    56. Taeniopygia guttata (zebra finch) tgu-miR-7-5p
    57. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-7
    58. Tor tambroides miR-7a
    59. Xenopus laevis xla-miR-7
    60. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-1139785
    61. Xenoturbella bocki Xbo-Mir-7_5p (mature (guide))
     Publications