Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-7a URS0000591950_7955

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Danio rerio. Annotated by 4 databases (MirGeneDB, miRBase, RefSeq, ENA). Described in 14 papers. Danio rerio (zebrafish) dre-miR-7a sequence is a product of mir7a-3, dre-miR-7a, mir7a-1, miR-7a, miR-7, mir7a-2 genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGAAGACUAGUGAUUUUGUUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 54 other species

    1. Aedes aegypti aae-miR-7
    2. Alligator mississippiensis (American alligator) ami-miR-7a-5p
    3. Anolis carolinensis (green anole) aca-miR-7-5p
    4. Anopheles gambiae (African malaria mosquito) aga-miR-7
    5. Apis mellifera (honey bee) ame-miR-7-5p
    6. Bombyx mori (domestic silkworm) bmo-miR-7-5p
    7. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-7-5p
    8. Branchiostoma floridae (Florida lancelet) bfl-miR-7
    9. Callorhinchus milii eshark_mir-7_2
    10. Canis lupus familiaris cfa-miR-7
    11. Ciona savignyi csa-miR-7
    12. Cricetulus griseus (Chinese hamster) cgr-miR-7a
    13. Culex quinquefasciatus (southern house mosquito) cqu-miR-7
    14. Daphnia pulex dpu-miR-7
    15. Drosophila ananassae dan-miR-7
    16. Drosophila erecta der-miR-7
    17. Drosophila grimshawi dgr-miR-7
    18. Drosophila melanogaster (fruit fly) dme-miR-7-5p
    19. Drosophila mojavensis dmo-miR-7
    20. Drosophila persimilis dpe-miR-7
    21. Drosophila pseudoobscura dps-miR-7
    22. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294419_df_nrg
    23. Drosophila sechellia dse-miR-7
    24. Drosophila simulans dsi-miR-7
    25. Drosophila willistoni dwi-miR-7
    26. Drosophila yakuba dya-miR-7
    27. Equus caballus eca-miR-7
    28. Gadus morhua (Atlantic cod) gmo-miR-7c-5p
    29. Gallus gallus Gallus_gallus piRNA piR-gga-291
    30. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-7
    31. Homo sapiens hsa-miR-7-5p
    32. Ictalurus punctatus ipu-miR-7a
    33. Ixodes scapularis (black-legged tick) isc-miR-7
    34. Lytechinus variegatus lva-miR-7-5p
    35. Macaca mulatta (Rhesus monkey) mml-miR-7
    36. Maylandia zebra (zebra mbuna) mze-miR-7b
    37. Mus musculus mmu-miR-7a-5p
    38. Nasonia longicornis nlo-miR-7
    39. Nasonia vitripennis nvi-miR-7
    40. Neolamprologus brichardi nbr-miR-7
    41. Oreochromis niloticus oni-miR-7
    42. Ornithorhynchus anatinus oan-miR-7-5p
    43. Pan troglodytes ptr-miR-7
    44. Patiria miniata pmi-miR-7-5p
    45. Petromyzon marinus (sea lamprey) pma-miR-7a-5p
    46. Pundamilia nyererei pny-miR-7
    47. Rattus norvegicus rno-miR-7a-5p
    48. Saccoglossus kowalevskii sko-miR-7-5p
    49. Salmo salar ssa-miR-7a-5p
    50. Strongylocentrotus purpuratus spu-miR-7
    51. Taeniopygia guttata (zebra finch) tgu-miR-7-5p
    52. Tetraodon nigroviridis tni-miR-7
    53. Tor tambroides (Thai mahseer) miR-7a
    54. Xenopus laevis xla-miR-7
    55. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-1139785