Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-7-5p URS0000591950_7227

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Drosophila melanogaster. Annotated by 5 databases (ENA, RefSeq, miRBase, FlyBase, PirBase). Drosophila melanogaster (fruit fly) dme-miR-7-5p sequence is a product of mir-7, dme-miR-7-5p, 7-R, miR-7, mir-7-RA, FBgn0262370, dme-miR-7, miR-7-5p, 7-RA genes. Found in the fruit fly reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGGAAGACUAGUGAUUUUGUUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 61 other species

    1. Aedes aegypti aae-miR-7
    2. Alligator mississippiensis (American alligator) ami-miR-7a-5p
    3. Anolis carolinensis (green anole) aca-miR-7-5p
    4. Anopheles gambiae aga-miR-7
    5. Apis mellifera ame-miR-7-5p
    6. Bombyx mori (domestic silkworm) bmo-miR-7-5p
    7. Branchiostoma belcheri bbe-miR-7-5p
    8. Branchiostoma floridae (Florida lancelet) bfl-miR-7
    9. Branchiostoma lanceolatum Bla-Mir-7_5p (mature (guide))
    10. Callorhinchus milii (elephant shark) Cmi-Mir-7-P1_5p (mature (guide))
    11. Canis lupus familiaris (dog) cfa-miR-7
    12. Centruroides sculpturatus Csc-Mir-7-P14_5p (mature (guide))
    13. Chrysemys picta bellii Cpi-Mir-7-P1_5p (mature (guide))
    14. Ciona savignyi csa-miR-7
    15. Cricetulus griseus cgr-miR-7a
    16. Culex quinquefasciatus cqu-miR-7
    17. Danio rerio (zebrafish) dre-miR-7a
    18. Daphnia pulex (common water flea) dpu-miR-7
    19. Drosophila ananassae dan-miR-7
    20. Drosophila erecta der-miR-7
    21. Drosophila grimshawi dgr-miR-7
    22. Drosophila mojavensis dmo-miR-7
    23. Drosophila persimilis dpe-miR-7
    24. Drosophila pseudoobscura dps-miR-7
    25. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294419_df_nrg
    26. Drosophila sechellia dse-miR-7
    27. Drosophila simulans dsi-miR-7
    28. Drosophila willistoni dwi-miR-7
    29. Drosophila yakuba dya-miR-7
    30. Equus caballus (horse) eca-miR-7
    31. Gadus morhua (Atlantic cod) gmo-miR-7c-5p
    32. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-291
    33. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-7
    34. Homo sapiens hsa-miR-7-5p
    35. Ictalurus punctatus ipu-miR-7a
    36. Ixodes scapularis isc-miR-7
    37. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-7_5p (mature (guide))
    38. Lytechinus variegatus (green sea urchin) lva-miR-7-5p
    39. Macaca mulatta (Rhesus monkey) mml-miR-7
    40. Maylandia zebra mze-miR-7b
    41. Monopterus albus (swamp eel) Mal-Mir-7-P4a_5p (mature (guide))
    42. Mus musculus mmu-miR-7a-5p
    43. Nasonia longicornis nlo-miR-7
    44. Nasonia vitripennis (jewel wasp) nvi-miR-7
    45. Neolamprologus brichardi nbr-miR-7
    46. Oreochromis niloticus oni-miR-7
    47. Ornithorhynchus anatinus (platypus) oan-miR-7-5p
    48. Pan troglodytes (chimpanzee) ptr-miR-7
    49. Patiria miniata pmi-miR-7-5p
    50. Petromyzon marinus (sea lamprey) pma-miR-7a-5p
    51. Pundamilia nyererei pny-miR-7
    52. Rattus norvegicus rno-miR-7a-5p
    53. Saccoglossus kowalevskii sko-miR-7-5p
    54. Salmo salar ssa-miR-7a-5p
    55. Strongylocentrotus purpuratus spu-miR-7
    56. Taeniopygia guttata (zebra finch) tgu-miR-7-5p
    57. Tetraodon nigroviridis tni-miR-7
    58. Tor tambroides miR-7a
    59. Xenopus laevis xla-miR-7
    60. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-1139785
    61. Xenoturbella bocki Xbo-Mir-7_5p (mature (guide))
    Publications New