Alligator mississippiensis (American alligator) ami-let-7b-3p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Alligator mississippiensis (American alligator) ami-let-7b-3p URS00005918D5_8496

22 nucleotides
1 database (miRBase)
Found in 6 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CUAUACAACCUACUGCCUUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Cavia porcellus cpo-let-7b-3p
Dasypus novemcinctus (nine-banded armadillo) dno-let-7b-3p
Homo sapiens (human) hsa-let-7b-3p
Macaca mulatta (Rhesus monkey) mml-let-7b-3p
Mus musculus (house mouse) mmu-let-7b-3p
Rattus norvegicus rno-let-7b-3p