Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-217 URS000058F867_9913

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACUGCAUCAGGAACUGAUUGGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-454585
  2. Canis lupus familiaris (dog) cfa-miR-217
  3. Gallus gallus gga-miR-217-5p
  4. Gorilla gorilla gorilla ggo-miR-217 (MIR217)
  5. Gorilla gorilla ggo-miR-217
  6. Monodelphis domestica mdo-miR-217
  7. Ophiophagus hannah oha-miR-217-5p
  8. Pan paniscus (pygmy chimpanzee) ppa-miR-217
  9. Sus scrofa (pig) ssc-miR-217
  10. Xenopus tropicalis (tropical clawed frog) xtr-miR-217
Publications