Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-217 URS000058F867_9823

Automated summary: This miRNA sequence is 24 nucleotides long and is found in Sus scrofa. Annotated by 2 databases (miRBase, RefSeq). Sus scrofa (pig) ssc-miR-217 sequence is a product of MIR217-1, miR-217, ssc-miR-217 genes. Found in the pig reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UACUGCAUCAGGAACUGAUUGGAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 10 other species

    1. Bos taurus (cattle) bta-miR-217
    2. Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-454585
    3. Canis lupus familiaris (dog) cfa-miR-217
    4. Gallus gallus gga-miR-217-5p
    5. Gorilla gorilla ggo-miR-217
    6. Homo sapiens (human) Hsa-Mir-217-v1_5p (mature (guide))
    7. Macaca mulatta Mml-Mir-217-v1_5p (mature (guide))
    8. Monodelphis domestica mdo-miR-217
    9. Ophiophagus hannah (king cobra) oha-miR-217-5p
    10. Pan paniscus ppa-miR-217
    11. Xenopus tropicalis (tropical clawed frog) xtr-miR-217
    Publications New