Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) FOXM1-regulated, gastric cancer associated (FRGCA) URS000058EF33_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

FRGCA: FRGCA is a long non-coding RNA (lncRNA) that has been associated with gastric cancer [PMC5354861]. Knockdown and overexpression experiments have shown that FRGCA plays a critical role in gastric cancer progression and has potential as a therapeutic target [PMC5354861]. Manual inspection of alignments with Integrated Genomics Viewer (IGV) revealed poor coverage in a 150-kb region of the genome where the majority of reads had a mapping quality of zero [PMC8950341]. This region includes the CBS, U2AF1, FRGCA, and CRYAA genes [PMC8950341]. In colorectal adenocarcinoma (COAD), FRGCA has been associated with diagnosis and prognosis through oxidative phosphorylation, ribosome metabolism, and metabolic pathways in the nucleoplasm [PMC7598802]. However, further studies are needed to validate these results and confirm the association between FRGCA expression and tumor progression in COAD [PMC7598802]. High expression of FRGCA is associated with better survival in COAD patients [PMC7598802]. The diagnostic significance of FRGCA expression has been demonstrated through receiver operating characteristic (ROC) curve analysis with an area under the curve (AUC) of 0.763 [PMC7598802]. The prognostic significance of FRGCA is confirmed through Kaplan-Meier plots and multivariate analysis [PMC7598802]. However, further functional trials are needed to explore the specific mechanisms underlying FRGCA's involvement in COAD progression as well as its potential diagnostic value for other tumors [PMC7598802].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCGCAGCGGACGCUCCCCACGAGGUAGAGCCCCGUUUCCACACCUGGAGCAGCUGCACCUGGAGGUGGGGCUCAUCUCCAGACCUGGAGCAGCUGCCUGCCCCAGGGCAGAAGCCACUGCCCGCAGCUAGGGAGCAUUGAGGAGGUCUCCCCAGGUCCGCGCGGGUUUUCUCCAGGUCCUCCAGUUUCCUCCCACAUCCCAAGUAUACACCUCAGCCUCACGGCAUGUCUACAUGGGCCUAGUCCGAGUGAGUGUGGGUGUCCCAUGGAGGCCUGUCCUAUCCAGGGCGGGUGCCCACCUUGGCACUGAGCCUCCAGGAUGGGCCCUGGUCACCUGCCACUCUGAACUGGAGAAAGCAAGUUGGAAAAUGAAUGAAUACAUGAAUAUAAAUUAUCAAAUAAAAAUUAUAAAGCCUACGGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications