Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-134 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-134 precursor URS0000589AA3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR134: MIR134 is a brain-enriched miRNA that is involved in various processes such as cell growth, differentiation, synaptic plasticity, neuroinflammation, and apoptosis [PMC6994828]. It has been found that knockdown of MIR134 in the ventral hippocampus (vHP) enhances the development of long-term potentiation (LTP) in CA1 pyramidal neurons [PMC6994828]. Dysregulation of miRNA biogenesis and increased levels of MIR134 have been observed in epilepsy and neurodegenerative disorders [PMC6994828]. In animal models, reducing brain levels of MIR134 has been shown to protect against seizures [PMC8178478]. In the context of cocaine exposure, knockdown of MIR134 expression in the vHP reduces anxiety-like and depression-like behaviors [PMC6994828]. MIR134 is expressed near synaptic sites on dendrites and enriched in synaptoneurosome [PMC6994828]. It has also been shown to be involved in cell proliferation and migration regulation [PMC5928554]. Additionally, MIR134 is a putative regulator of INA (inhibin alpha subunit) and acts on translation initiation factor like 5A-1/2 [PMC7281098] [PMC7753210]. Overall, these findings suggest that MIR134 plays a significant role in various neurological processes and may have therapeutic potential for conditions such as epilepsy and cocaine addiction.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGGGUGUGUGACUGGUUGACCAGAGGGGCAUGCACUGUGUUCACCCUGUGGGCCACCUAGUCACCAACCCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

2D structure Publications