Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-125b precursor (hsa-mir-125b-2) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-125b precursor (hsa-mir-125b-2) URS000058997A_9606

  • 89 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 116 species

Automated summary: This pre miRNA sequence is 89 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (ENA, Ensembl/GENCODE, miRBase, HGNC, GeneCards, RefSeq, Ensembl, MalaCards). Described in 56 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (lin-4, RF00052). Homo sapiens (human) microRNA hsa-mir-125b precursor (hsa-mir-125b-2) sequence is a product of mir-125b-2, mir-125b-2 precurso, hsa-mir-125b-2 precursor, MIR125B2, ENSG00000207863.1, mir-125b-2 precursor genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACCAGACUUUUCCUAGUCCCUGAGACCCUAACUUGUGAGGUAUUUUAGUAACAUCACAAGUCAGGCUCUUGGGACCUAGGCGGAGGGGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 115 other species

    1. Ailuropoda melanoleuca microRNA 125b-2 (ENSAMEG00000022531.2)
    2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-125b precursor (age-mir-125b-2)
    3. Balaenoptera musculus (Blue whale) miRNA (ENSBMSG00010015149.1)
    4. Callithrix jacchus (white-tufted-ear marmoset) miRNA (ENSCJAG00000027577.2)
    5. Camelus dromedarius microRNA 125b-2 (ENSCDRG00005000017.1)
    6. Canis lupus dingo (dingo) microRNA 125b-2 (ENSCAFG00020026403.1)
    7. Canis lupus familiaris (dog) miRNA (ENSCAFG00000020578.1, ENSCAFG00030007692.1, ENSCAFG00040025941.1)
    8. Carlito syrichta miRNA (ENSTSYG00000019734.2)
    9. Castor canadensis (American beaver) miRNA (ENSCCNG00000014735.1)
    10. Catagonus wagneri microRNA 125b-2 (ENSCWAG00000019303.1)
    11. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000019774.1)
    12. Chlorocebus sabaeus miRNA (ENSCSAG00000025446.1)
    13. Colobus angolensis palliatus miRNA (ENSCANG00000013865.1)
    14. Dasypus novemcinctus (nine-banded armadillo) miRNA (ENSDNOG00000028106.1)
    15. Delphinapterus leucas (beluga whale) microRNA 125b-2 (ENSDLEG00000009449.1)
    16. Echinops telfairi miRNA (ENSETEG00000021222.1)
    17. Erinaceus europaeus miRNA (ENSEEUG00000016001.1)
    18. Felis catus (domestic cat) miRNA (ENSFCAG00000024651.3)
    19. Gorilla gorilla gorilla ggo-mir-125b-2 (ENSGGOG00000033475.2)
    20. Gorilla gorilla (western gorilla) microRNA ggo-mir-125b precursor (ggo-mir-125b-2)
    21. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-125b precursor (lla-mir-125b-2)
    22. Lemur catta microRNA lca-mir-125b precursor
    23. Loxodonta africana (African savanna elephant) microRNA 125b-2 (ENSLAFG00000024899.1)
    24. Lynx canadensis microRNA 125b-2 (ENSLCNG00005011093.1)
    25. Macaca fascicularis miRNA (ENSMFAG00000006263.2)
    26. Macaca mulatta microRNA mml-mir-125b precursor (mml-mir-125b-2)
    27. Macaca nemestrina microRNA mne-mir-125b precursor (mne-mir-125b-2)
    28. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000010962.1)
    29. Marmota marmota marmota (Alpine marmot) miRNA (ENSMMMG00000010541.1, ENSMMMG00000017025.1)
    30. Microcebus murinus (gray mouse lemur) miRNA (ENSMICG00000033176.2)
    31. Monodon monoceros (narwhal) miRNA (ENSMMNG00015000163.1)
    32. Nomascus leucogenys miRNA (ENSNLEG00000023414.2)
    33. Oryctolagus cuniculus microRNA 125b-2 (ENSOCUG00000019177.1)
    34. Pan paniscus miRNA (ENSPPAG00000021257.1)
    35. Panthera leo microRNA 125b-2 (ENSPLOG00000017567.1)
    36. Panthera pardus microRNA 125b-2 (ENSPPRG00000014246.1)
    37. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000002187.1)
    38. Pan troglodytes (chimpanzee) microRNA ptr-mir-125b precursor (ptr-mir-125b-2)
    39. Papio anubis miRNA (ENSPANG00000002261.2)
    40. Phocoena sinus (vaquita) miRNA (ENSPSNG00000012444.1)
    41. Physeter catodon microRNA 125b-2 (ENSPCTG00005021090.1)
    42. Pongo abelii microRNA 125b-2 (ENSPPYG00000021257.1)
    43. Pongo pygmaeus microRNA ppy-mir-125b precursor (ppy-mir-125b-2)
    44. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000014287.1)
    45. Propithecus coquereli miRNA (ENSPCOG00000010806.1)
    46. Pteropus vampyrus miRNA (ENSPVAG00000025451.1)
    47. Rhinopithecus bieti miRNA (ENSRBIG00000020283.1)
    48. Rhinopithecus roxellana miRNA (ENSRROG00000028130.1)
    49. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000006828.1)
    50. Sciurus vulgaris (Eurasian red squirrel) miRNA (ENSSVLG00005016255.1)
    51. Spermophilus dauricus miRNA (ENSSDAG00000002771.1)
    52. Sus scrofa microRNA ssc-mir-125b precursor (ssc-mir-125b-2)
    53. Theropithecus gelada microRNA 125b-2 (ENSTGEG00000000963.1)
    54. Tursiops truncatus miRNA (ENSTTRG00000024083.1)
    55. Urocitellus parryii (Arctic ground squirrel) miRNA (ENSUPAG00010019619.1)
    56. Ursus americanus miRNA (ENSUAMG00000009795.1)
    57. Ursus maritimus (Polar bear) miRNA (ENSUMAG00000014529.1)
    58. Ursus thibetanus thibetanus microRNA 125b-2 (ENSUTTG00000004809.1)
    59. Vicugna pacos miRNA (ENSVPAG00000016707.1, ENSVPAG00000016744.1)
    60. Vulpes vulpes miRNA (ENSVVUG00000023895.1)
    61. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015002668.1)
    2D structure New