Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1273c URS000058878F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1273c: Hsa-mir-1273c is a microRNA that has been studied in various contexts. It has been shown to be differentially expressed in rejection samples compared to samples without rejection, as well as in colorectal cancer (CRC) cell lines and primary tumors [PMC5585727] [PMC6912472] [PMC3279428]. In the context of rejection, hsa-mir-1273c was found to be upregulated during rejection compared to samples without rejection, and its expression further increased in acute rejection (AR) samples [PMC6912472]. In CRC, hsa-mir-1273c was found to be frequently mutated in microsatellite instability (MSI) CRCs [PMC3279428]. Additionally, hsa-mir-1273c has been associated with melanoma and its upregulation has been observed in melanoma samples [PMC4289319]. The functional role of hsa-mir-1273c is not well understood, but it has been shown to regulate the expression of target genes such as BMP6, GPX3, and VPS8 [PMC9777571]. Furthermore, hsa-mir-1273c was found to have higher expression levels for its 3p arm compared to its originally annotated 5p arm [PMC3303722]. Overall, hsa-mir-1273c is a microRNA that exhibits differential expression and mutations in various contexts such as rejection and cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCGACAAAACGAGACCCUGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications