v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-10b URS000058760A_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-10b: Bta-mir-10b is a microRNA that has been identified as a relevant regulator for muscle fatty acid composition in Nelore cattle [PMC6637853]. It has also been found to be highly abundant in germinal vesicle oocytes [PMC4522283]. In fetal bovine ovary, bta-mir-10b is expressed at a 10-fold greater level compared to somatic tissue pools, along with other miRNAs such as bta-miR-99a, bta-miR-199a-3p, bta-miR-199a-5p, bta-miR-424, bta-miR-100, bta-miR-455, and bta-miR-214 [PMC4522283]. Additionally, in both preovulatory and subordinate follicles of cattle, bta-mir-10b is commonly expressed along with other miRNAs like bta-miR-26a [PMC4438052]. Furthermore, it has been identified as a candidate regulator for conjugated linoleic acid (CLA) by both RIF2 and PIF analyses and is also considered a hub miRNA by WGCNA [PMC6637853].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UACCCUGUAGAACCGAAUUUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Callorhinchus milii Cmi-Mir-10-P1b-v1_5p (mature (guide))
  2. Danio rerio (zebrafish) dre-miR-10b-5p
  3. Equus caballus eca-miR-10b
  4. Gallus gallus Gallus_gallus piRNA piR-gga-10163
  5. Gekko japonicus Gja-Mir-10-P1b-v1_5p (mature (guide))
  6. Homo sapiens (human) hsa-miR-10b-5p
  7. Latimeria chalumnae Lch-Mir-10-P1d_5p (mature (guide))
  8. Lepisosteus oculatus (spotted gar) Loc-Mir-10-P1d-v1_5p (mature (guide))
  9. Macaca mulatta mml-miR-10b-5p
  10. Microcaecilia unicolor Mun-Mir-10-P1b-v1_5p (mature (guide))
  11. Mus musculus (house mouse) mmu-miR-10b-5p
  12. Pan troglodytes ptr-miR-10b
  13. Pongo pygmaeus ppy-miR-10b
  14. Python bivittatus (Burmese python) Pbv-Mir-10-P1d-v1_5p (mature (guide))
  15. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63031
  16. Scyliorhinus torazame Sto-Mir-10-P1b-v1_5p (mature (guide))
  17. Takifugu rubripes (torafugu) fru-miR-10b
  18. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-10b
  19. Tor tambroides miR-10b-5p
  20. Tupaia chinensis (Chinese tree shrew) tch-miR-10b-5p
  21. Xenopus laevis Xla-Mir-10-P1b3-v1_5p (mature (guide))
  22. Xenopus tropicalis Xtr-Mir-10-P1b-v1_5p (mature (guide))
 Publications