v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-10163 URS000058760A_9031

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UACCCUGUAGAACCGAAUUUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Bos taurus bta-miR-10b
  2. Callorhinchus milii Cmi-Mir-10-P1b-v1_5p (mature (guide))
  3. Danio rerio (zebrafish) dre-miR-10b-5p
  4. Equus caballus eca-miR-10b
  5. Gekko japonicus Gja-Mir-10-P1b-v1_5p (mature (guide))
  6. Homo sapiens (human) hsa-miR-10b-5p
  7. Latimeria chalumnae Lch-Mir-10-P1d_5p (mature (guide))
  8. Lepisosteus oculatus (spotted gar) Loc-Mir-10-P1d-v1_5p (mature (guide))
  9. Macaca mulatta mml-miR-10b-5p
  10. Microcaecilia unicolor Mun-Mir-10-P1b-v1_5p (mature (guide))
  11. Mus musculus (house mouse) mmu-miR-10b-5p
  12. Pan troglodytes ptr-miR-10b
  13. Pongo pygmaeus ppy-miR-10b
  14. Python bivittatus (Burmese python) Pbv-Mir-10-P1d-v1_5p (mature (guide))
  15. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63031
  16. Scyliorhinus torazame Sto-Mir-10-P1b-v1_5p (mature (guide))
  17. Takifugu rubripes (torafugu) fru-miR-10b
  18. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-10b
  19. Tor tambroides miR-10b-5p
  20. Tupaia chinensis (Chinese tree shrew) tch-miR-10b-5p
  21. Xenopus laevis Xla-Mir-10-P1b3-v1_5p (mature (guide))
  22. Xenopus tropicalis Xtr-Mir-10-P1b-v1_5p (mature (guide))