Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-10b-5p URS000058760A_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (ENA, LncBase, MalaCards, GeneCards, TarBase, miRBase, PSICQUIC, RefSeq). Described in 81 papers. Homo sapiens (human) hsa-miR-10b-5p sequence is a product of 162, miR-10b, MIR10B, miR-10, hsa-miR-10b, miR-10b-5p, miR-162, hsa-miR-10b-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3, 182-FIP, 21-GARP, 24p3, 4-1BB-L, 4-1BBL, 4F2, 4F2HC, 4T2HC, 5'OY11.1.

Interactions 10

According to PSICQUIC, Homo sapiens (human) hsa-miR-10b-5p interacts with:

Interaction id Participant Synonyms
URS000058760A_9606-6 P17948 P17948
URS000058760A_9606-0 P17948 P17948
URS000058760A_9606-1 P23560 P23560
URS000058760A_9606-2 P23560 P23560
URS000058760A_9606-3 P28358 P28358
URS000058760A_9606-7 P28358 P28358
URS000058760A_9606-5 Q07869 Q07869
URS000058760A_9606-8 Q07869 Q07869
URS000058760A_9606-9 Q07955 Q07955
URS000058760A_9606-4 Q07955 Q07955

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UACCCUGUAGAACCGAAUUUGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 141 other species

    Publications New