Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-10b-5p URS000058760A_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-10b: Mmu-mir-10b is a microRNA that has been predicted to bind to four sites within the 3' untranslated region (3'UTR) of various genes [PMC4902921]. It is a paralogous sequence of mmu-miR-10a, with the two sequences differing at only one or two positions [PMC1347474]. Mmu-mir-10b has been found to regulate the expression of ACO1, along with MMU-MIR-339 [PMC6391818]. It has also been identified as one of the unique microRNAs found in either CM or NI MV [PMC5946432]. In a study, Rb1 was found to significantly inhibit the expression of mmu-mir-10b, along with other microRNAs such as mmu-miR-134 and mmu-miR-191 [PMC9120625]. MicroRNAs are named based on various criteria, including species designation and nucleotide differences in mature miRNAs [PMC3521996]. Mmu-mir-10a and mmu-mir-10b have been identified as heterozygous mutants without mosaicism in F1 pups [PMC3797721]. Genome editing activities have been confirmed for mmu-mir-10b at a rate of 1.2% in sequencing analysis [PMC3797721]. TALEN pairs have been used for genome editing of mmu-mir-10a and mmu-mir-10b in NIH3T3 cultured cell line experiments [PMC3797721]. Mmu-mir-10b has also been found to be downregulated in early-symptomatic α-synuclein (A30P)-transgenic mice, along with other microRNAs such as mmu-miR-212 and mmu-miR495. It has been associated with spermatogenesis and enhanced spermatogonial stem cell proliferation [PMC5116472]. These findings contribute to our understanding of the functions of microRNAs in various diseases and provide insights for diagnosis, treatment, and prevention [PMC7347495].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACCCUGUAGAACCGAAUUUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

Publications