Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1323 URS000058276F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1323: Hsa-mir-1323 is a microRNA that is involved in the development of neuroblastoma [PMC6531850]. Higher circulating levels of serum hsa-mir-1323 have also been associated with gestational diabetes mellitus (GDM) [PMC9313007]. Several other microRNAs have been identified as potential regulators of the expression levels of E-cadherin and clusterin, including hsa-miR-320a-3p, hsa-miR-17-5p, hsa-miR-21-5p, hsa-miR-25-3p, hsa-miR-138-5p, hsa-miR-34a-5p, and hsa-miR92a3p [PMC8064394]. Hsa-mir1323 has also been validated as a target for rs3749585 and shown to regulate the expression of CORIN [PMC8365884]. Additionally, it has been found that HsamiRNA1323 is one of the miRNAs that target CXCL1 and CXCL8 [PMC9391105]. Overall, these findings suggest that HsamiRNA1323 plays a role in various biological processes and may have potential implications in neuroblastoma development and GDM.

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAAAACUGAGGGGCAUUUUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-1323
  2. Macaca mulatta Mml-Mir-1323_5p (mature (guide))
  3. Pan troglodytes ptr-miR-1323
  4. Pongo pygmaeus ppy-miR-1323
Publications