Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saccharomyces cerevisiae S288C Promoting Watson RNA URS0000580240_559292

  • 941 nucleotides
  • 3 databases (ENA, RefSeq, SGD)
  • Found in 3 species
  • ncRNA

Automated summary: This sRNA sequence is 941 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 3 databases (RefSeq, SGD, ENA). Described in 15 papers. Saccharomyces cerevisiae S288C Promoting Watson RNA sequence is a product of PWR1 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CGGAUGUGUGGAUAAAAAGAACAUGGAAAACGAGUGCAGCAACGACUAUAUUUAAAAUAGUAUCAUUCAUAAUUCGAUAGAUGGACUUUUCAGCUACUUGUAAACGGCGAAAUUGUGUCUAAGUUGUGAAUGAGCUUUUCAUUUUCAUUUGCGUACCGAAGUGGUAAAACUGACGACCUAAAGUACGAUAUACGGAAUAAAGCAAGUUCUAAUACUCUCUGCAGUUUGACCAGUGCUACUUGGCGCUGUUCAUUCCAAUUAGCCGUAAAUUUGUGAAAUAGAUCCCAAGAUAAUCUCCGUUUUAUUUGCUUCCAAAGAGGUUAUCUUUUUAAUAGUUGGCAUUUUCUAGCUUCUUGGUUGCUAUAAGGCAUAGUUGAAGUGCAGUGAGAGGAAGAGGGGAACUCACGGAAAGAGACUCCUUAUACUUUUGUCAACCGGUGUGUUCCAAAAUUCGCUAGUUAAACGUUUUAUUAGCAGCGGUCCCAUUGAGCCAAAACCCCGCUGAGCGUUGCGACACAAUCUGAUCAUACCACAUAAUCAUUGCAGCGCCUACUUUUUAACUUCUAGCAGCCAAAUUGUUAUUCAGAUUUAGUUGGCGGUACGACUCCUUACAGCAGUAAAUUAUUCGAAUUAGUAACAAACGAGUGAUUGGUAUGUGGAGAUAGGAAACGAAGACUGAGCAGAAGCACCCACGCUAAGUAAUUGUAUUCUUGAAUUGGGAGCCUGAAGAAUUAUGAUCAAGCUCAGCAUCUUUCCGUAGCGUCUUCGAGAAUUUGUCCUGUGAGCGGAAGGUUGAAAGUUAUAAAUGAUGUCUUAUUUUUUUGCAUGAUCUCCCCAGACCCAGAUGUCAUCUGUAAAGAAUUUAGUAGGACAAUUGAAGACGCUGUCUUCCAAUUGAUUCAGCGAAACCUUUUCUUAAGAUCAUUCAUAUUCUUGUCAAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 2 other species

    1. Saccharomyces cerevisiae Long non-coding antisense RNA PWR1
    2. Saccharomyces cerevisiae YJM1615 PWR1
    3. Saccharomyces cerevisiae YJM555 PWR1