Cochliomyia macellaria (secondary screw-worm) mature cma-miR-996-3p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cochliomyia macellaria (secondary screw-worm) mature cma-miR-996-3p URS000057B362_66361

22 nucleotides
1 database (ENA)
Found in 6 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UGACUAGAUUUCAUGCUCGUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Cochliomyia hominivorax (primary screw-worm) mature cho-miR-996-3p
Drosophila ananassae Dan-Mir-279-P3_3p (mature (guide))
Drosophila melanogaster dme-miR-996-3p
Drosophila mojavensis Dmo-Mir-279-P3_3p (mature (guide))
Drosophila simulans Dsi-Mir-279-P3_3p (mature (guide))
Drosophila yakuba Dya-Mir-279-P3_3p (mature (guide))