v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-181b-5p URS0000574E81_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AACAUUCAUUGCUGUCGGUGGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Alligator mississippiensis (American alligator) ami-miR-181b-5p
  2. Anolis carolinensis (green anole) Aca-Mir-181-P2b_5p (mature (guide))
  3. Bos taurus bta-miR-181b
  4. Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-484596
  5. Callorhinchus milii Cmi-Mir-181-P2b_5p (mature (guide))
  6. Canis lupus familiaris Cfa-Mir-181-P2b_5p (mature (guide))
  7. Cavia porcellus cpo-miR-181b-5p
  8. Chrysemys picta bellii Cpi-Mir-181-P2b_5p (mature (guide))
  9. Chrysemys picta cpi-miR-181b-5p
  10. Columba livia cli-miR-181b-5p
  11. Danio rerio (zebrafish) Dre-Mir-181-P2c1_5p (mature (guide))
  12. Dasypus novemcinctus dno-miR-181b-5p
  13. Drosophila erecta Drosophila_erecta piRNA piR-der-12904
  14. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-21035062
  15. Echinops telfairi Ete-Mir-181-P2b_5p (mature (guide))
  16. Gadus morhua gmo-miR-181b-5p
  17. Gallus gallus Gga-Mir-181-P2b_5p (mature (guide))
  18. Gekko japonicus Gja-Mir-181-P2b_5p (mature (guide))
  19. Gorilla gorilla gorilla ggo-miR-181b (MIR181B)
  20. Gorilla gorilla (western gorilla) ggo-miR-181b
  21. Hippoglossus hippoglossus hhi-miR-181b
  22. Homo sapiens Hsa-Mir-181-P2b_5p (mature (guide))
  23. Lagothrix lagotricha lla-miR-181b
  24. Latimeria chalumnae (coelacanth) Lch-Mir-181-P2b_5p (mature (guide))
  25. Lepisosteus oculatus Loc-Mir-181-P2b_5p (mature (guide))
  26. Macaca mulatta (Rhesus monkey) mml-miR-181b-5p
  27. Macaca nemestrina mne-miR-181b
  28. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-181-P2b_5p (mature (guide))
  29. Monopterus albus (swamp eel) Mal-Mir-181-P2b2_5p (mature (guide))
  30. Ornithorhynchus anatinus Oan-Mir-181-P2a_5p (mature (guide))
  31. Oryctolagus cuniculus (rabbit) ocu-miR-181b-5p
  32. Oryzias latipes (Japanese medaka) ola-miR-181b-5p
  33. Pan paniscus (pygmy chimpanzee) ppa-miR-181b
  34. Pan troglodytes microRNA mir-181b-1
  35. Pongo pygmaeus (Bornean orangutan) microRNA mir-181b-1
  36. Pteropus alecto pal-miR-181b-5p
  37. Python bivittatus Pbv-Mir-181-P2b_5p (mature (guide))
  38. Rattus norvegicus (Norway rat) Rno-Mir-181-P2b_5p (mature (guide))
  39. Sarcophilus harrisii Sha-Mir-181-P2a_5p (mature (guide))
  40. Scyliorhinus torazame (cloudy catshark) Sto-Mir-181-P2b_5p (mature (guide))
  41. Sphenodon punctatus Spt-Mir-181-P2c3_5p (mature (guide))
  42. Sus scrofa ssc-miR-181b
  43. Taeniopygia guttata (zebra finch) tgu-miR-181b-5p
  44. Xenopus laevis (African clawed frog) Xla-Mir-181-P2b3_5p (mature (guide))
  45. Xenopus tropicalis Xtr-Mir-181-P2b_5p (mature (guide))
 Publications