Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-20a-5p URS0000574A2C_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (ENA, miRBase, MirGeneDB, TarBase, GeneCards, RefSeq, MalaCards, PSICQUIC, LncBase, IntAct). Described in 115 papers. Homo sapiens (human) hsa-miR-20a-5p sequence is a product of miR-20a, hsa-miR-20a, MIR20A, miR-20a-5p, hsa-miR-20a-5p, miR-20 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-8D, 1-8U, 11B6, 133K02, 14-3-3-zeta, 17-1A, 1700010H15RiK, 182-FIP, 2'-PDE, 20D7-FC4.

Interactions 61

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-20a-5p interacts with:

Interaction id Participant Synonyms
EBI-21019197 intact:EBI-21019154 EBI-21019154 ENST00000227507 mrna_ccnd1
EBI-21277358 intact:EBI-21273597 EBI-21273597 ENST00000262768 mrna_timp2
EBI-21277370 intact:EBI-21277117 EBI-21277117 ENST00000313654 mrna_lama3
EBI-21277380 intact:EBI-21277239 EBI-21277239 ENST00000396578 mrna_col4a3
EBI-22030950 intact:EBI-22030861 EBI-22030861 ENST00000622179.4 mrna_sirpa
EBI-25565110 intact:EBI-25470264 EBI-25470264 ENST00000403681 mrna_hmga2
EBI-25566870 URS000075C808_9606 EBI-25566873 URS000075C808_9606 lnc_hotair
URS0000574A2C_9606-0 O15539 O15539
URS0000574A2C_9606-28 O15539 O15539
URS0000574A2C_9606-29 O95150 O95150
URS0000574A2C_9606-1 O95150 O95150
URS0000574A2C_9606-30 P01130 P01130
URS0000574A2C_9606-2 P01130 P01130
URS0000574A2C_9606-31 P05067 P05067
URS0000574A2C_9606-3 P05067 P05067
URS0000574A2C_9606-32 P10721 P10721
URS0000574A2C_9606-4 P10721 P10721
URS0000574A2C_9606-5 P13725 P13725
URS0000574A2C_9606-33 P13725 P13725
URS0000574A2C_9606-34 P15692 P15692
URS0000574A2C_9606-35 P15692 P15692
URS0000574A2C_9606-6 P15692 P15692
URS0000574A2C_9606-7 P15692 P15692
URS0000574A2C_9606-36 P17302 P17302
URS0000574A2C_9606-8 P17302 P17302
URS0000574A2C_9606-37 P22362 P22362
URS0000574A2C_9606-9 P22362 P22362
URS0000574A2C_9606-10 P37173 P37173
URS0000574A2C_9606-38 P37173 P37173
URS0000574A2C_9606-11 P37231 P37231
URS0000574A2C_9606-39 P37231 P37231
URS0000574A2C_9606-13 P38936 P38936
URS0000574A2C_9606-40 P38936 P38936
URS0000574A2C_9606-12 P38936 P38936
URS0000574A2C_9606-41 P46734 P46734
URS0000574A2C_9606-14 P46734 P46734
URS0000574A2C_9606-42 P50549 P50549
URS0000574A2C_9606-15 P50549 P50549
URS0000574A2C_9606-16 P54764 P54764
URS0000574A2C_9606-43 P54764 P54764
URS0000574A2C_9606-44 P78324 P78324
URS0000574A2C_9606-26 P78324 P78324
URS0000574A2C_9606-17 Q13145 Q13145
URS0000574A2C_9606-45 Q13145 Q13145
URS0000574A2C_9606-27 Q13873 Q13873
URS0000574A2C_9606-46 Q13873 Q13873
URS0000574A2C_9606-18 Q13976 Q13976
URS0000574A2C_9606-47 Q15818 Q15818
URS0000574A2C_9606-19 Q15818 Q15818
URS0000574A2C_9606-20 Q8NFP9 Q8NFP9
URS0000574A2C_9606-48 Q8NFP9 Q8NFP9
URS0000574A2C_9606-49 Q92886 Q92886
URS0000574A2C_9606-21 Q92886 Q92886
URS0000574A2C_9606-22 Q9BYX2 Q9BYX2
URS0000574A2C_9606-50 Q9BYX2 Q9BYX2
URS0000574A2C_9606-51 Q9HB63 Q9HB63
URS0000574A2C_9606-23 Q9HB63 Q9HB63
URS0000574A2C_9606-24 Q9NZV1 Q9NZV1
URS0000574A2C_9606-52 Q9NZV1 Q9NZV1
URS0000574A2C_9606-53 Q9NZV1 Q9NZV1
URS0000574A2C_9606-25 Q9NZV1 Q9NZV1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAAAGUGCUUAUAGUGCAGGUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 82 other species

    1. Alligator mississippiensis ami-miR-20a-5p
    2. Anolis carolinensis Aca-Mir-17-P3a_5p (mature (guide))
    3. Bos taurus (cattle) bta-miR-20a
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-20a
    5. Canis lupus familiaris (dog) cfa-miR-20a
    6. Capra hircus chi-miR-20a-5p
    7. Cavia porcellus cpo-miR-20a-5p
    8. Cervus elaphus (red deer) cel-miR-20a
    9. Chrysemys picta bellii Cpi-Mir-17-P3a_5p (mature (guide))
    10. Columba livia Cli-Mir-17-P3a_5p (mature (guide))
    11. Cricetulus griseus (Chinese hamster) cgr-miR-20a
    12. Cyprinus carpio (common carp) ccr-miR-20a-5p
    13. Danio rerio dre-miR-20a-5p
    14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-20a-5p
    15. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-3108187
    16. Equus caballus eca-miR-20a
    17. Gadus morhua (Atlantic cod) gmo-miR-20a-5p
    18. Gallus gallus (chicken) gga-miR-20a-5p
    19. Haplochromis burtoni abu-miR-20a
    20. Macaca mulatta Mml-Mir-17-P3a_5p (mature (guide))
    21. Maylandia zebra (zebra mbuna) mze-miR-20a
    22. Microcebus murinus (gray mouse lemur) mmr-miR-20
    23. Monodelphis domestica (gray short-tailed opossum) mdo-miR-20a-5p
    24. Mus musculus mmu-miR-20a-5p
    25. Neolamprologus brichardi nbr-miR-20a
    26. Nomascus leucogenys nle-miR-20
    27. Ophiophagus hannah oha-miR-20a-5p
    28. Oreochromis niloticus (Nile tilapia) oni-miR-20
    29. Ornithorhynchus anatinus Oan-Mir-17-P3a4_5p (mature (guide))
    30. Oryctolagus cuniculus ocu-miR-20a-5p
    31. Ovis aries (sheep) miscellaneous RNA
    32. Pteropus alecto (black flying fox) pal-miR-20a-5p
    33. Pundamilia nyererei pny-miR-20a
    34. Python bivittatus pbv-miR-20a-5p
    35. Rattus norvegicus rno-miR-20a-5p
    36. Salmo salar ssa-miR-20a-5p
    37. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-17-P3a_5p (mature (guide))
    38. Scyliorhinus torazame (cloudy catshark) Sto-Mir-17-P3a_5p (mature (guide))
    39. Taeniopygia guttata (zebra finch) tgu-miR-20a-5p
    40. Takifugu rubripes fru-miR-20
    41. Tetraodon nigroviridis tni-miR-20
    42. Tor tambroides miR-20a-5p
    43. Xenopus laevis xla-miR-20a-5p
    44. Xenopus tropicalis xtr-miR-20a-5p