Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-574-5p URS000057466C_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 6 databases (LncBase, miRBase, PirBase, TarBase, RefSeq, ENA). Described in 18 papers. Mus musculus (house mouse) mmu-miR-574-5p sequence is a product of mmu-miR-574-5p, Mir574, miR-574, mmu-miR-574, miR-574-5p genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610007D13Rik, 0610011L14Rik, 0610013I17Rik, 0610025K21Rik, 0610038L10Rik, 0610039N19Rik, 0710001G09Rik, 0710001K01Rik, 0710008J23Rik, 0710008K06Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAGUGUGUGUGUGUGAGUGUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 26 other species

    1. Homo sapiens (human) hsa-miR-574-5p
    2. Sus scrofa ssc-miR-574-5p