Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-107-3p URS00005743AE_10116

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Rattus norvegicus. Annotated by 4 databases (PSICQUIC, RefSeq, miRBase, MirGeneDB). Described in 23 papers. Rattus norvegicus (Norway rat) rno-miR-107-3p sequence is a product of miR-107-3p, miR-107, rno-miR-107-3p, Mir107, rno-miR-107 genes. Found in the norway rat reference genome.

Interactions 2

According to PSICQUIC, Rattus norvegicus (Norway rat) rno-miR-107-3p interacts with:

Interaction id Participant Synonyms
URS00005743AE_10116-0 Q8R2E7 Q8R2E7
URS00005743AE_10116-1 Q8R2E7 Q8R2E7

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGCAGCAUUGUACAGGGCUAUCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 55 other species

    1. Alligator mississippiensis Ami-Mir-103-P2_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-103-P3_3p (mature (guide))
    3. Bos taurus (cattle) Bta-Mir-103-P3_3p (mature (guide))
    4. Canis lupus familiaris (dog) Cfa-Mir-103-P3_3p (mature (guide))
    5. Capra hircus miR-107
    6. Cavia porcellus cpo-miR-107-3p
    7. Chrysemys picta bellii Cpi-Mir-103-P3_3p (mature (guide))
    8. Columba livia Cli-Mir-103-P3_3p (mature (guide))
    9. Danio rerio dre-miR-107a-3p
    10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-107-3p
    11. Echinops telfairi Ete-Mir-103-P3_3p (mature (guide))
    12. Equus caballus eca-miR-107b
    13. Gallus gallus (chicken) gga-miR-107-3p
    14. Gorilla gorilla (western gorilla) ggo-miR-107
    15. Homo sapiens (human) hsa-miR-107
    16. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA miR-107
    17. Lagothrix lagotricha (brown woolly monkey) lla-miR-107
    18. Macaca mulatta mml-miR-107-3p
    19. Macaca nemestrina mne-miR-107
    20. Monodelphis domestica (gray short-tailed opossum) mdo-miR-107
    21. Mus musculus mmu-miR-107-3p
    22. Ophiophagus hannah oha-miR-107-3p
    23. Ornithorhynchus anatinus Oan-Mir-103-P3_3p (mature (guide))
    24. Oryctolagus cuniculus ocu-miR-107-3p
    25. Ovis aries (sheep) miscellaneous RNA
    26. Pan paniscus ppa-miR-107
    27. Pan troglodytes (chimpanzee) ptr-miR-107
    28. Pongo pygmaeus ppy-miR-107
    29. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-103-P3_3p (mature (guide))
    30. Scyliorhinus torazame (cloudy catshark) Sto-Mir-103-P3_3p (mature (guide))
    31. Sus scrofa ssc-miR-107
    32. Taeniopygia guttata (zebra finch) tgu-miR-107
    33. Tetraodon nigroviridis tni-miR-107
    34. Tor tambroides miR-107a-3p
    35. Xenopus tropicalis xtr-miR-107