Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-107-3p URS00005743AE_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, ENA, MirGeneDB, TarBase, PirBase, LncBase, miRBase). Described in 28 papers. Mus musculus (house mouse) mmu-miR-107-3p sequence is a product of miR-107-3p, miR-107, mmu-miR-107-3p, mmu-miR-107, Mir107 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610008P16Rik, 0610009B22Rik, 0610011H21Rik, 0610011L04Rik, 0610030G24Rik, 0610040J01Rik, 0610041L09Rik, 0710008J23Rik, 107kDa, 1110004C05Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGCAGCAUUGUACAGGGCUAUCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 34 other species

    1. Alligator mississippiensis Ami-Mir-103-P2_3p (mature (guide))
    2. Anolis carolinensis (green anole) Aca-Mir-103-P3_3p (mature (guide))
    3. Bos taurus (cattle) Bta-Mir-103-P3_3p (mature (guide))
    4. Canis lupus familiaris (dog) Cfa-Mir-103-P3_3p (mature (guide))
    5. Capra hircus (goat) miR-107
    6. Cavia porcellus cpo-miR-107-3p
    7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-103-P3_3p (mature (guide))
    8. Columba livia Cli-Mir-103-P3_3p (mature (guide))
    9. Danio rerio dre-miR-107a-3p
    10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-107-3p
    11. Echinops telfairi Ete-Mir-103-P3_3p (mature (guide))
    12. Equus caballus eca-miR-107b
    13. Gallus gallus (chicken) gga-miR-107-3p
    14. Gorilla gorilla (western gorilla) ggo-miR-107
    15. Homo sapiens (human) hsa-miR-107
    16. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA miR-107
    17. Lagothrix lagotricha lla-miR-107
    18. Macaca mulatta (Rhesus monkey) mml-miR-107-3p
    19. Macaca nemestrina (pig-tailed macaque) mne-miR-107
    20. Monodelphis domestica mdo-miR-107
    21. Ophiophagus hannah (king cobra) oha-miR-107-3p
    22. Ornithorhynchus anatinus (platypus) Oan-Mir-103-P3_3p (mature (guide))
    23. Oryctolagus cuniculus (rabbit) ocu-miR-107-3p
    24. Ovis aries miscellaneous RNA
    25. Pan paniscus ppa-miR-107
    26. Pan troglodytes ptr-miR-107
    27. Pongo pygmaeus (Bornean orangutan) ppy-miR-107
    28. Rattus norvegicus rno-miR-107-3p
    29. Sarcophilus harrisii Sha-Mir-103-P3_3p (mature (guide))
    30. Scyliorhinus torazame Sto-Mir-103-P3_3p (mature (guide))
    31. Sus scrofa ssc-miR-107
    32. Taeniopygia guttata (zebra finch) tgu-miR-107
    33. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-107
    34. Tor tambroides (Thai mahseer) miR-107a-3p
    35. Xenopus tropicalis (tropical clawed frog) xtr-miR-107