v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila melanogaster (fruit fly) mitochondrial transfer RNA:Methionine-CAT (Dmel_CR34062) secondary structure diagram

Drosophila melanogaster (fruit fly) mitochondrial transfer RNA:Methionine-CAT (Dmel_CR34062) URS0000572BCA_7227

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAAAAGAUAAGCUAAUUAAGCUACUGGGUUCAUACCCCAUUUAUAAAGGUUAUAAUCCUUUUCUUUUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 48 other species

  1. Aedes aegypti (yellow fever mosquito) tRNA-Met
  2. Anopheles culicifacies tRNA-Met
  3. Anopheles funestus tRNA-Met
  4. Anopheles funestus-like sensu Spillings et al. (2009) tRNA-Met
  5. Anopheles longipalpis tRNA-Met
  6. Anopheles maculatus tRNA-Met
  7. Anopheles minimus tRNA-Met
  8. Anopheles parensis tRNA-Met
  9. Anopheles sp. NFL-2015 tRNA-Met
  10. Anopheles stephensi (Asian malaria mosquito) tRNA-Met
  11. Anopheles vaneedeni tRNA-Met
  12. Archisepsis discolor tRNA-Met
  13. Bactrocera correcta (guava fruit fly) tRNA-Met
  14. Chamaepsila rosae tRNA-Met
  15. Chrysops dissectus tRNA-Met
  16. Chrysops sp. tRNA-Met
  17. Chymomyza costata tRNA-Met
  18. Clinotanypus yani tRNA-Met
  19. Culex pipiens pallens tRNA-Met
  20. Drosophila affinis tRNA-Met
  21. Drosophila algonquin tRNA-Met
  22. Drosophila athabasca tRNA-Met
  23. Drosophila biarmipes tRNA-Met
  24. Drosophila bifasciata tRNA-Met
  25. Drosophila bipectinata tRNA-Met
  26. Drosophila burlai tRNA-Met
  27. Drosophila eugracilis tRNA-Met
  28. Drosophila ficusphila tRNA-Met
  29. Drosophila guanche tRNA-Met
  30. Drosophila gunungcola tRNA-Met
  31. Drosophila kikkawai tRNA-Met
  32. Drosophila malerkotliana tRNA-Met
  33. Drosophila santomea tRNA-Met
  34. Drosophila subobscura tRNA-Met
  35. Drosophila suzukii tRNA-Met
  36. Drosophila takahashii tRNA-Met
  37. Drosophila teissieri tRNA-Met
  38. Drosophila yakuba tRNA
  39. Glossina morsitans morsitans tRNA
  40. Hemipenthes neimengguensis tRNA-Met
  41. Hermetia illucens tRNA-Met
  42. Microsepsis sp. ACMJ-2016 tRNA-Met
  43. Onthophagus rorarius tRNA-Met
  44. Rhagio tringarius tRNA-Met
  45. Sciomyza simplex tRNA-Met
  46. Taxigramma karakulensis tRNA-Met
  47. Tinda javana tRNA-Met
  48. Xylophagus ater tRNA-Met
 2D structure Publications