Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-124b URS000056E1DA_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-miR-124a: Bta-mir-124a is a microRNA that has been found to play a role in inhibiting the production of multiple target genes [PMC6699390]. In a study examining the effects of bta-mir-124a in mammary epithelial cells of dairy cows, it was observed that overexpression of bta-mir-124a led to the inhibition of multiple target genes [PMC6699390]. Additionally, the study investigated the impact of both overexpression and inhibition of bta-mir-124a on triglyceride (TG) levels in mammary epithelial cells [PMC6699390]. The results indicated that overexpression and inhibition of bta-mir-124a had an effect on TG levels, although specific details regarding the magnitude and directionality of this effect were not provided in the given context [PMC6699390]. Overall, these findings suggest that bta-mir-124a has regulatory functions in gene expression and may be involved in modulating TG levels in mammary epithelial cells. Further research is needed to fully understand the mechanisms by which bta-mir-124a exerts its effects and its potential implications for dairy cow health and milk production [PMC6699390].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAGGCACGCGGUGAAUGCCAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Anopheles gambiae (African malaria mosquito) aga-miR-124
  2. Apis mellifera (honey bee) ame-miR-124-3p
  3. Bombyx mori (domestic silkworm) bmo-miR-124
  4. Daphnia pulex dpu-miR-124
  5. Drosophila ananassae dan-miR-124
  6. Drosophila erecta der-miR-124
  7. Drosophila grimshawi dgr-miR-124
  8. Drosophila melanogaster (fruit fly) dme-miR-124-3p
  9. Drosophila mojavensis dmo-miR-124
  10. Drosophila persimilis dpe-miR-124
  11. Drosophila pseudoobscura dps-miR-124
  12. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294479_df_nrg
  13. Drosophila sechellia dse-miR-124
  14. Drosophila simulans dsi-miR-124
  15. Drosophila virilis dvi-miR-124-3p
  16. Drosophila willistoni dwi-miR-124
  17. Drosophila yakuba dya-miR-124
  18. Ixodes scapularis (black-legged tick) isc-miR-124
  19. Nasonia vitripennis nvi-miR-124
  20. Ophiophagus hannah (king cobra) oha-miR-124-3p
  21. Tribolium castaneum (red flour beetle) tca-miR-124-3p
Publications