Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Apis mellifera (honey bee) ame-miR-124-3p URS000056E1DA_7460

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ame-mir-124: Ame-mir-124 is a miRNA that has been found to be upregulated in virgin queens and is speculated to be involved in the modulation of sensory and neuronal functions associated with mating behaviors [PMC4444961]. Another miRNA, ame-miR-275, is increased in expression in mated queens and may play a role in initiating egg-laying behavior [PMC4444961]. A study of the miRNA transcriptome in honey bee queens found that ame-mir-124 and ame-miR-275 are differentially expressed in virgin and mated queens [PMC4444961]. Ame-mir-124, along with other miRNAs such as ame-miR-3791, ame-miR-981, and ame-miR-6038, has been shown to target various genes involved in honey bee physiology, including the ecdysone receptor (Ecr) and the nAChRα2 subunit [PMC7206646]. Additionally, ame-mir-124 has been predicted to target the Toll-related receptor gene 18w, which is involved in antimicrobial immune defenses [PMC7206646]. Thiamethoxam exposure was found to significantly alter the expression of several miRNAs including ame-mir-124 [PMC7206646]. In workers, the expression of ame-mir-124 was significantly higher compared to queens, suggesting neuronal maturation occurring at a specific developmental stage [PMC4704047].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAGGCACGCGGUGAAUGCCAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Anopheles gambiae (African malaria mosquito) aga-miR-124
  2. Bombyx mori (domestic silkworm) bmo-miR-124
  3. Bos taurus bta-miR-124b
  4. Daphnia pulex dpu-miR-124
  5. Drosophila ananassae dan-miR-124
  6. Drosophila erecta der-miR-124
  7. Drosophila grimshawi dgr-miR-124
  8. Drosophila melanogaster (fruit fly) dme-miR-124-3p
  9. Drosophila mojavensis dmo-miR-124
  10. Drosophila persimilis dpe-miR-124
  11. Drosophila pseudoobscura dps-miR-124
  12. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294479_df_nrg
  13. Drosophila sechellia dse-miR-124
  14. Drosophila simulans dsi-miR-124
  15. Drosophila virilis dvi-miR-124-3p
  16. Drosophila willistoni dwi-miR-124
  17. Drosophila yakuba dya-miR-124
  18. Ixodes scapularis (black-legged tick) isc-miR-124
  19. Nasonia vitripennis nvi-miR-124
  20. Ophiophagus hannah (king cobra) oha-miR-124-3p
  21. Tribolium castaneum (red flour beetle) tca-miR-124-3p
Publications