Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-124 URS000056E1DA_7091

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Bombyx mori. Annotated by 2 databases (miRBase, RefSeq). Described in 3 papers. Bombyx mori (domestic silkworm) bmo-miR-124 sequence is a product of Mir124, miR-124, bmo-miR-124 genes. Found in the domestic silkworm reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAAGGCACGCGGUGAAUGCCAAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 130 other species

    1. Anopheles gambiae aga-miR-124
    2. Apis mellifera ame-miR-124-3p
    3. Bos taurus bta-miR-124b
    4. Daphnia pulex (common water flea) dpu-miR-124
    5. Drosophila ananassae dan-miR-124
    6. Drosophila erecta der-miR-124
    7. Drosophila grimshawi dgr-miR-124
    8. Drosophila melanogaster (fruit fly) dme-miR-124-3p
    9. Drosophila mojavensis dmo-miR-124
    10. Drosophila persimilis dpe-miR-124
    11. Drosophila pseudoobscura dps-miR-124
    12. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294479_df_nrg
    13. Drosophila sechellia dse-miR-124
    14. Drosophila simulans dsi-miR-124
    15. Drosophila virilis dvi-miR-124-3p
    16. Drosophila willistoni dwi-miR-124
    17. Drosophila yakuba dya-miR-124
    18. Ixodes scapularis isc-miR-124
    19. Nasonia vitripennis (jewel wasp) nvi-miR-124
    20. Ophiophagus hannah (king cobra) oha-miR-124-3p
    21. Tribolium castaneum tca-miR-124-3p
    Publications New