Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-219a URS0000565C8D_9031

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Gallus gallus. Annotated by 2 databases (RefSeq, miRBase). Described in 3 papers. Gallus gallus (chicken) gga-miR-219a sequence is a product of MIR219, miR-219, gga-miR-219a, miR-219a genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAUUGUCCAAACGCAAUUCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 39 other species

    1. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-219-5p
    2. Branchiostoma floridae bfl-miR-219
    3. Canis lupus familiaris (dog) cfa-miR-219-5p
    4. Capitella teleta cte-miR-219
    5. Capra hircus chi-miR-219
    6. Drosophila erecta miR-219-RA
    7. Drosophila melanogaster (fruit fly) dme-miR-219-5p
    8. Drosophila mojavensis miR-219-RA
    9. Drosophila pseudoobscura pseudoobscura miR-219-RA
    10. Drosophila virilis miR-219-RA
    11. Drosophila yakuba miR-219-RA
    12. Equus caballus eca-miR-219-5p
    13. Gorilla gorilla (western gorilla) ggo-miR-219
    14. Homo sapiens (human) hsa-miR-219a-5p
    15. Macaca mulatta mml-miR-219
    16. Monodelphis domestica (gray short-tailed opossum) mdo-miR-219-5p
    17. Mus musculus mmu-miR-219a-5p
    18. Pan troglodytes (chimpanzee) ptr-miR-219-5p
    19. Pongo pygmaeus ppy-miR-219-5p
    20. Pteropus alecto (black flying fox) pal-miR-219a-5p
    21. Rattus norvegicus rno-miR-219a-5p
    22. Tribolium castaneum tca-miR-219-5p
    23. Xenopus tropicalis xtr-miR-219