Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-219-5p URS0000565C8D_7227

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Drosophila melanogaster. Annotated by 4 databases (miRBase, ENA, RefSeq, FlyBase). Described in 12 papers. Drosophila melanogaster (fruit fly) dme-miR-219-5p sequence is a product of miR-219-5p, 219-R, 219-RA, FBgn0262376, miR-219, dme-miR-219, mir-219, dme-miR-219-5p, mir-219-RA genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAUUGUCCAAACGCAAUUCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 22 other species

    1. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-219-5p
    2. Branchiostoma floridae (Florida lancelet) bfl-miR-219
    3. Canis lupus familiaris cfa-miR-219-5p
    4. Capitella teleta cte-miR-219
    5. Capra hircus (goat) chi-miR-219
    6. Drosophila erecta miR-219-RA
    7. Drosophila mojavensis miR-219-RA
    8. Drosophila pseudoobscura pseudoobscura miR-219-RA
    9. Drosophila virilis miR-219-RA
    10. Drosophila yakuba miR-219-RA
    11. Equus caballus eca-miR-219-5p
    12. Gallus gallus gga-miR-219a
    13. Gorilla gorilla (western gorilla) ggo-miR-219
    14. Homo sapiens hsa-miR-219a-5p
    15. Macaca mulatta (Rhesus monkey) mml-miR-219
    16. Monodelphis domestica (gray short-tailed opossum) mdo-miR-219-5p
    17. Mus musculus mmu-miR-219a-5p
    18. Pan troglodytes ptr-miR-219-5p
    19. Pongo pygmaeus ppy-miR-219-5p
    20. Pteropus alecto (black flying fox) pal-miR-219a-5p
    21. Rattus norvegicus rno-miR-219a-5p
    22. Tribolium castaneum (red flour beetle) tca-miR-219-5p
    23. Xenopus tropicalis (tropical clawed frog) xtr-miR-219