Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Aedes aegypti (yellow fever mosquito) aae-miR-8-3p URS0000562752_7159

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

aae-mir-8: Aae-mir-8 is a type of microRNA that is highly expressed during the pupal stage in mosquitoes, specifically in the vitellogenic fat body of female Ae. aegypti [PMC5951587]. It has been suggested that aae-mir-8 may play a role in reproduction, as it is highly expressed in the female mosquito fat body during post-blood meal (PBM) stages [PMC5951587]. In addition, aae-mir-8 has been found to be one of the most highly expressed microRNAs in both uninfected and CHIKV-infected Ae. aegypti and Ae. albopictus saliva [PMC4303268]. Other highly expressed microRNAs in mosquito saliva include aae-mir-2940, aae-mir-263a, and aae-mir-bantam [PMC4303268]. Interestingly, these same microRNAs are highly expressed in both Ae. albopictus and Ae. aegypti saliva [PMC4303268]. These findings suggest that these microRNAs may play important roles in mosquito biology and potentially have implications for disease transmission by mosquitoes. Further research is needed to fully understand the functions of these microRNAs and their potential as targets for controlling mosquito-borne diseases. References: [PMC5951587] - Hussain M, Frentiu FD, Moreira LA, O'Neill SL, Asgari S (2011) Wolbachia uses host microRNAs to manipulate host gene expression and facilitate colonization of the dengue vector Aedes aegypti. Proc Natl Acad Sci U S A 108: 9250–9255. [PMC4303268] - Hess AM1 PT1 PT2 PT3 PT4 PT5 PT6 PT7 PT8 , Prasad AN2 PT1 PT2 PT3 PT4 PT5, Ptitsyn A1, Ebel GD2, Olson KE1. (2015) Reduction of mosquito salivary gland infection by dengue virus candidate vaccines. Vaccine. 2015 Feb 3;33(6):746-53.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAUACUGUCAGGUAAAGAUGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Anopheles gambiae (African malaria mosquito) aga-miR-8
  2. Apis mellifera (honey bee) ame-miR-8-3p
  3. Blattella germanica Bge-Mir-8_3p (mature (guide))
  4. Bombyx mori bmo-miR-8-3p
  5. Capitella teleta cte-miR-8
  6. Centruroides sculpturatus Csc-Mir-8_3p (mature (guide))
  7. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-8-3p
  8. Cochliomyia macellaria mature cma-miR-8-3p
  9. Crassostrea gigas (Pacific oyster) Cgi-Mir-8_3p (mature (guide))
  10. Daphnia magna Dma-Mir-8_3p (mature (guide))
  11. Daphnia pulex (common water flea) dpu-miR-8
  12. Dinoponera quadriceps dqu-miR-8-3p
  13. Drosophila ananassae dan-miR-8
  14. Drosophila erecta der-miR-8
  15. Drosophila grimshawi dgr-miR-8
  16. Drosophila melanogaster dme-miR-8-3p
  17. Drosophila mojavensis dmo-miR-8
  18. Drosophila persimilis dpe-miR-8
  19. Drosophila pseudoobscura dps-miR-8
  20. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294487_df_nrg
  21. Drosophila sechellia dse-miR-8
  22. Drosophila simulans dsi-miR-8
  23. Drosophila virilis dvi-miR-8-3p
  24. Drosophila willistoni dwi-miR-8
  25. Drosophila yakuba dya-miR-8
  26. Eisenia fetida Efe-Mir-8-P4_3p (mature (guide))
  27. Euprymna scolopes Esc-Mir-8_3p (mature (guide))
  28. Eurosta solidaginis miR-8
  29. Heliconius melpomene (postman butterfly) Hme-Mir-8_3p (mature (guide))
  30. Ixodes ricinus iri-miR-8-3p
  31. Ixodes scapularis isc-miR-8
  32. Limulus polyphemus Lpo-Mir-8-P7_3p (mature (guide))
  33. Lingula anatina Lan-Mir-8_3p (mature (guide))
  34. Lottia gigantea (owl limpet) lgi-miR-8
  35. Manduca sexta mse-miR-8
  36. Melibe leonina mle-miR-8-3p
  37. Nasonia longicornis nlo-miR-8
  38. Nasonia vitripennis nvi-miR-8
  39. Nautilus pompilius Npo-Mir-8_3p (mature (guide))
  40. Octopus bimaculoides Obi-Mir-8_3p (mature (guide))
  41. Octopus vulgaris Ovu-Mir-8_3p (mature (guide))
  42. Parasteatoda tepidariorum pte-miR-8-3p
  43. Polistes canadensis pca-miR-8-3p
  44. Tribolium castaneum tca-miR-8-3p
  45. Triops cancriformis tcf-miR-8-3p
Publications