Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Polistes canadensis pca-miR-8-3p URS0000562752_91411

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Polistes canadensis. Annotated by 1 database (miRBase).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAAUACUGUCAGGUAAAGAUGUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 45 other species

    1. Aedes aegypti (yellow fever mosquito) aae-miR-8-3p
    2. Anopheles gambiae (African malaria mosquito) aga-miR-8
    3. Apis mellifera (honey bee) ame-miR-8-3p
    4. Blattella germanica (German cockroach) Bge-Mir-8_3p (mature (guide))
    5. Bombyx mori (domestic silkworm) bmo-miR-8-3p
    6. Capitella teleta cte-miR-8
    7. Centruroides sculpturatus (bark scorpion) Csc-Mir-8_3p (mature (guide))
    8. Cochliomyia hominivorax mature cho-miR-8-3p
    9. Cochliomyia macellaria mature cma-miR-8-3p
    10. Crassostrea gigas (Pacific oyster) Cgi-Mir-8_3p (mature (guide))
    11. Daphnia magna Dma-Mir-8_3p (mature (guide))
    12. Daphnia pulex dpu-miR-8
    13. Dinoponera quadriceps dqu-miR-8-3p
    14. Drosophila ananassae dan-miR-8
    15. Drosophila erecta der-miR-8
    16. Drosophila grimshawi dgr-miR-8
    17. Drosophila melanogaster dme-miR-8-3p
    18. Drosophila mojavensis dmo-miR-8
    19. Drosophila persimilis dpe-miR-8
    20. Drosophila pseudoobscura dps-miR-8
    21. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294487_df_nrg
    22. Drosophila sechellia dse-miR-8
    23. Drosophila simulans dsi-miR-8
    24. Drosophila virilis dvi-miR-8-3p
    25. Drosophila willistoni dwi-miR-8
    26. Drosophila yakuba dya-miR-8
    27. Eisenia fetida Efe-Mir-8-P4_3p (mature (guide))
    28. Euprymna scolopes Esc-Mir-8_3p (mature (guide))
    29. Eurosta solidaginis miR-8
    30. Heliconius melpomene (postman butterfly) Hme-Mir-8_3p (mature (guide))
    31. Ixodes ricinus iri-miR-8-3p
    32. Ixodes scapularis (black-legged tick) isc-miR-8
    33. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-8-P7_3p (mature (guide))
    34. Lingula anatina Lan-Mir-8_3p (mature (guide))
    35. Lottia gigantea lgi-miR-8
    36. Manduca sexta mse-miR-8
    37. Melibe leonina mle-miR-8-3p
    38. Nasonia longicornis nlo-miR-8
    39. Nasonia vitripennis (jewel wasp) nvi-miR-8
    40. Nautilus pompilius Npo-Mir-8_3p (mature (guide))
    41. Octopus bimaculoides Obi-Mir-8_3p (mature (guide))
    42. Octopus vulgaris (common octopus) Ovu-Mir-8_3p (mature (guide))
    43. Parasteatoda tepidariorum (common house spider) pte-miR-8-3p
    44. Tribolium castaneum tca-miR-8-3p
    45. Triops cancriformis tcf-miR-8-3p