Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila virilis dvi-miR-8-3p URS0000562752_7244

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Drosophila virilis. Annotated by 2 databases (Ensembl Metazoa, miRBase). Described in 1 paper. Drosophila virilis dvi-miR-8-3p sequence is a product of FBtr0297074_df_nrg gene. Found in the Drosophila virilis reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAAUACUGUCAGGUAAAGAUGUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 40 other species

    1. Aedes aegypti aae-miR-8-3p
    2. Anopheles gambiae aga-miR-8
    3. Apis mellifera ame-miR-8-3p
    4. Blattella germanica Bge-Mir-8_3p (mature (guide))
    5. Bombyx mori (domestic silkworm) bmo-miR-8-3p
    6. Capitella teleta cte-miR-8
    7. Cochliomyia hominivorax mature cho-miR-8-3p
    8. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-8-3p
    9. Crassostrea gigas (Pacific oyster) Cgi-Mir-8_3p (mature (guide))
    10. Daphnia pulex dpu-miR-8
    11. Dasypus novemcinctus Dan-Mir-8_3p (mature (guide))
    12. Dinoponera quadriceps dqu-miR-8-3p
    13. Drosophila ananassae dan-miR-8
    14. Drosophila erecta der-miR-8
    15. Drosophila grimshawi dgr-miR-8
    16. Drosophila melanogaster dme-miR-8-3p
    17. Drosophila mojavensis dmo-miR-8
    18. Drosophila persimilis dpe-miR-8
    19. Drosophila pseudoobscura dps-miR-8
    20. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294487_df_nrg
    21. Drosophila sechellia dse-miR-8
    22. Drosophila simulans dsi-miR-8
    23. Drosophila willistoni dwi-miR-8
    24. Drosophila yakuba dya-miR-8
    25. Eisenia fetida (common brandling worm) Efe-Mir-8-P4_3p (mature (guide))
    26. Eurosta solidaginis miR-8
    27. Heliconius melpomene Hme-Mir-8_3p (mature (guide))
    28. Ixodes ricinus iri-miR-8-3p
    29. Ixodes scapularis isc-miR-8
    30. Lingula anatina Lan-Mir-8_3p (mature (guide))
    31. Lottia gigantea (owl limpet) lgi-miR-8
    32. Manduca sexta mse-miR-8
    33. Melibe leonina mle-miR-8-3p
    34. Nasonia longicornis nlo-miR-8
    35. Nasonia vitripennis nvi-miR-8
    36. Parasteatoda tepidariorum pte-miR-8-3p
    37. Polistes canadensis pca-miR-8-3p
    38. Tribolium castaneum tca-miR-8-3p
    39. Triops cancriformis tcf-miR-8-3p