Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Capitella teleta cte-miR-8 URS0000562752_283909

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Capitella teleta. Annotated by 3 databases (MirGeneDB, miRBase, ENA). Capitella teleta cte-miR-8 sequence is a product of cte-miR-8, miR-8 genes. Found in the Capitella teleta reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAAUACUGUCAGGUAAAGAUGUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 45 other species

    1. Aedes aegypti (yellow fever mosquito) aae-miR-8-3p
    2. Anopheles gambiae aga-miR-8
    3. Apis mellifera ame-miR-8-3p
    4. Blattella germanica Bge-Mir-8_3p (mature (guide))
    5. Bombyx mori bmo-miR-8-3p
    6. Centruroides sculpturatus (bark scorpion) Csc-Mir-8_3p (mature (guide))
    7. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-8-3p
    8. Cochliomyia macellaria mature cma-miR-8-3p
    9. Crassostrea gigas (Pacific oyster) Cgi-Mir-8_3p (mature (guide))
    10. Daphnia magna Dma-Mir-8_3p (mature (guide))
    11. Daphnia pulex dpu-miR-8
    12. Dinoponera quadriceps dqu-miR-8-3p
    13. Drosophila ananassae dan-miR-8
    14. Drosophila erecta der-miR-8
    15. Drosophila grimshawi dgr-miR-8
    16. Drosophila melanogaster dme-miR-8-3p
    17. Drosophila mojavensis dmo-miR-8
    18. Drosophila persimilis dpe-miR-8
    19. Drosophila pseudoobscura dps-miR-8
    20. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294487_df_nrg
    21. Drosophila sechellia dse-miR-8
    22. Drosophila simulans dsi-miR-8
    23. Drosophila virilis dvi-miR-8-3p
    24. Drosophila willistoni dwi-miR-8
    25. Drosophila yakuba dya-miR-8
    26. Eisenia fetida Efe-Mir-8-P4_3p (mature (guide))
    27. Euprymna scolopes Esc-Mir-8_3p (mature (guide))
    28. Eurosta solidaginis miR-8
    29. Heliconius melpomene (postman butterfly) Hme-Mir-8_3p (mature (guide))
    30. Ixodes ricinus (castor bean tick) iri-miR-8-3p
    31. Ixodes scapularis (black-legged tick) isc-miR-8
    32. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-8-P7_3p (mature (guide))
    33. Lingula anatina Lan-Mir-8_3p (mature (guide))
    34. Lottia gigantea (owl limpet) lgi-miR-8
    35. Manduca sexta (tobacco hornworm) mse-miR-8
    36. Melibe leonina mle-miR-8-3p
    37. Nasonia longicornis nlo-miR-8
    38. Nasonia vitripennis nvi-miR-8
    39. Nautilus pompilius Npo-Mir-8_3p (mature (guide))
    40. Octopus bimaculoides Obi-Mir-8_3p (mature (guide))
    41. Octopus vulgaris Ovu-Mir-8_3p (mature (guide))
    42. Parasteatoda tepidariorum (common house spider) pte-miR-8-3p
    43. Polistes canadensis pca-miR-8-3p
    44. Tribolium castaneum (red flour beetle) tca-miR-8-3p
    45. Triops cancriformis tcf-miR-8-3p
    Publications New