Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-298-5p URS0000561F50_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-298: Mmu-mir-298 is a microRNA that has been studied in various contexts. In a study, it was found that mmu-mir-298 was up-regulated in the colon and down-regulated in the forestomach [PMC4209037]. Another study showed that mmu-mir-298, along with mmu-miR-141 and mmu-miR-375, were released into the serum with disease progression [PMC8855122]. Exosomes were found to play a major role in the transfer of mmu-mir-298 [PMC4496353]. The transfer of mmu-mir-298 from endothelial cells to tumor cells was observed, although HCT116 cells showed reduced transfer levels [PMC4496353]. Mmu-mir-298 has been shown to have potentially downregulated target genes in the ileum [PMC3084815]. It has also been found to directly act on the 3'–UTR of CYP3A4 [PMC4629097]. It is important to note that there are differences between mature hsa-miR-298 and mmu-mir-298 sequences, highlighting the need for human systems for verification [PMC8758483]. Mmu-mir-298 has also been shown to influence CYP3A4 expression along with miRNA27-b [PMC8972743]. The expression of HSA-miR-299-3p and mmu-mir-298 is up-regulated in SLE and down-regulated in ITP, potentially serving as a biomarker for differentiation between these conditions [PMC9096216]. Mmu-mir-298 has also been observed to target IKKi/IKKϵ when expressed during SA1 and SA2 infection [PMC4114167]. In various experiments, mimics of mmu-mir 291–3p, mmu-mir-25, mmu-mir-302, mmu-mir-292-5p, mmu-mir-106a, mmu-mir-21, and mmu-mir-298 were used [PMC3422281].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCAGAGGAGGGCUGUUCUUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Rattus norvegicus rno-miR-298-5p
Publications