Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-10a-5p URS000055DE1B_9031

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (ENA, RefSeq, miRBase, MirGeneDB). Gallus gallus (chicken) gga-miR-10a-5p sequence is a product of gga-miR-10a, miR-10, 10a, gga-miR-10a-5p, miR-10a-5p, miR-10a, MIR10A, 10 genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UACCCUGUAGAUCCGAAUUUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 57 other species

    1. Aedes aegypti Aae-Mir-10-P1-v2_5p (mature (guide))
    2. Alligator mississippiensis (American alligator) Ami-Mir-10-P1c-v1_5p (mature (guide))
    3. Anolis carolinensis (green anole) Aca-Mir-10-P1c-v1_5p (mature (guide))
    4. Blattella germanica (German cockroach) Bge-Mir-10-P1-v2_5p (mature (guide))
    5. Bos taurus Bta-Mir-10-P1c-v1_5p (mature (guide))
    6. Branchiostoma belcheri bbe-miR-10a-5p
    7. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-10a
    8. Callorhinchus milii (elephant shark) eshark_mir-10_2
    9. Canis lupus familiaris (dog) cfa-miR-10a
    10. Capra hircus chi-miR-10a-5p
    11. Chiloscyllium plagiosum microRNA cpl-miR-10a-5p
    12. Chrysemys picta bellii Cpi-Mir-10-P1c-v1_5p (mature (guide))
    13. Chrysemys picta cpi-miR-10a-5p
    14. Columba livia Cli-Mir-10-P1c-v1_5p (mature (guide))
    15. Crassostrea gigas Cgi-Mir-10-P1_5p (mature (guide))
    16. Cricetulus griseus cgr-miR-10a-5p
    17. Danio rerio (zebrafish) dre-miR-10a-5p
    18. Daphnia magna Dma-Mir-10-P1-v2_5p (mature (guide))
    19. Daphnia pulex (common water flea) dpu-miR-10
    20. Dasypus novemcinctus Dno-Mir-10-P1c-v1_5p (mature (guide))
    21. Dinoponera quadriceps dqu-miR-10-5p
    22. Echinops telfairi Ete-Mir-10-P1c-v1_5p (mature (guide))
    23. Gadus morhua (Atlantic cod) gmo-miR-10d-5p
    24. Heliconius melpomene (postman butterfly) Hme-Mir-10-P1-v2_5p (mature (guide))
    25. Homo sapiens Hsa-Mir-10-P1c-v1_5p (mature (guide))
    26. Ictalurus punctatus ipu-miR-10a
    27. Ixodes ricinus iri-miR-10a-5p
    28. Ixodes scapularis isc-miR-10
    29. Latimeria chalumnae (coelacanth) Lch-Mir-10-P1c_5p (mature (guide))
    30. Lepisosteus oculatus (spotted gar) Loc-Mir-10-P1c-v1_5p (mature (guide))
    31. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-10-P1k-v2_5p (mature (guide))
    32. Locusta migratoria lmi-miR-10-5p
    33. Lottia gigantea (owl limpet) lgi-miR-10
    34. Macaca mulatta (Rhesus monkey) Mml-Mir-10-P1c-v1_5p (mature (guide))
    35. Microcebus murinus (gray mouse lemur) mmr-miR-10a
    36. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-10-P1c-v1_5p (mature (guide))
    37. Mus musculus Mmu-Mir-10-P1c-v1_5p (mature (guide))
    38. Nautilus pompilius Npo-Mir-10-P1_5p (mature (guide))
    39. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-10a
    40. Ornithorhynchus anatinus (platypus) oan-miR-10a-5p
    41. Oryctolagus cuniculus ocu-miR-10a-5p
    42. Otolemur garnettii oga-miR-10a
    43. Papio hamadryas (hamadryas baboon) pha-miR-10a
    44. Parasteatoda tepidariorum (common house spider) pte-miR-10-5p
    45. Penaeus japonicus miR-10a
    46. Plutella xylostella pxy-miR-10-5p
    47. Pteropus alecto (black flying fox) pal-miR-10a-5p
    48. Rattus norvegicus Rno-Mir-10-P1c-v1_5p (mature (guide))
    49. Saimiri boliviensis boliviensis sbo-miR-10a
    50. Sarcophilus harrisii Sha-Mir-10-P1c-v1_5p (mature (guide))
    51. Spodoptera frugiperda sfr-miR-10-5p
    52. Sus scrofa (pig) ssc-miR-10a-5p
    53. Taeniopygia guttata (zebra finch) Tgu-Mir-10-P1c-v1_5p (mature (guide))
    54. Tor tambroides miR-10a-5p
    55. Tribolium castaneum tca-miR-10-5p
    56. Triops cancriformis tcf-miR-10-5p
    57. Xenopus laevis xla-miR-10a
    Publications New