Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-429 URS000055BBE5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-429: Hsa-mir-429 is a microRNA that has been identified as a potential detection marker for bladder urothelial carcinoma, with a high range, sensitivity, specificity, and Youden index [PMC10017875]. It has been found to inhibit the Raf/MEK/ERK pathway by targeting the CRK like proto-oncogene adaptor protein [PMC8548936]. This inhibition leads to a reduction in the migration of liver cancer cells and the reversal of epithelial-mesenchymal transition [PMC8548936]. The detection function of hsa-mir-429 is considered to be very good, as indicated by its high values for range, sensitivity, specificity, and Youden index [PMC10017875]. This microRNA has shown promise as a potential marker for bladder urothelial carcinoma due to its strong detection capabilities [PMC10017875]. Additionally, hsa-mir-429's ability to inhibit the Raf/MEK/ERK pathway suggests its potential therapeutic value in liver cancer by reducing cell migration and reversing epithelial-mesenchymal transition [PMC8548936].

mRNA interactions 5 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAUACUGUCUGGUAAAACCGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications