Homo sapiens (human) hsa-miR-429 URS000055BBE5_9606

• 22 nucleotides
• 10 databases (ENA, GeneCards, IntAct, LncBase, MalaCards, miRBase, MirGeneDB, PSICQUIC, RefSeq, TarBase)
• Found in 28 species
• 2064 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (ENA, miRBase, LncBase, MirGeneDB, RefSeq, GeneCards, MalaCards, PSICQUIC, TarBase, IntAct). Described in 71 papers. Homo sapiens (human) hsa-miR-429 sequence is a product of miR-429, MIR429, hsa-miR-429 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 133K02, 1700010H15RiK, 3-10C, 39K2, 3alpha-HSD, 4-HPPD-L, 4EHP, 6-16, 6.8PL, 7B2.

Interactions 9

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-429 interacts with:

Interaction id	Participant	Synonyms
EBI-20564332	URS0000A77400_9606	EBI-17172839 URS0000A77400_9606 lncrn_malat1 human
URS000055BBE5_9606-4	P05067	P05067
URS000055BBE5_9606-0	P05067	P05067
URS000055BBE5_9606-1	P23443	P23443
URS000055BBE5_9606-5	P23443	P23443
URS000055BBE5_9606-6	Q07157	Q07157
URS000055BBE5_9606-2	Q07157	Q07157
URS000055BBE5_9606-3	Q16625	Q16625
URS000055BBE5_9606-7	Q16625	Q16625

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location	Chromosome	Start	End	Strand	Ensembl	UCSC	Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
Go to location loading browser Can't view - strange chromosome name	{{ location.chromosome }}	{{ location.start | number }}	{{ location.end | number }}	{{ location.strand == "1" ? "forward" : "reverse" }}	{{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }}	UCSC	100%	{{ location.identity * 100 | number:0 }}%

No genome locations found for this sequence. Learn more →

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UAAUACUGUCUGGUAAAACCGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-429
2. Macaca mulatta (Rhesus monkey) mml-miR-429-3p
3. Pongo pygmaeus (Bornean orangutan) ppy-miR-429

Publications New Download

• FASTA
• JSON