Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-429 URS000055BBE5_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (ENA, miRBase, LncBase, MirGeneDB, RefSeq, GeneCards, MalaCards, PSICQUIC, TarBase, IntAct). Described in 71 papers. Homo sapiens (human) hsa-miR-429 sequence is a product of miR-429, MIR429, hsa-miR-429 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 133K02, 1700010H15RiK, 3-10C, 39K2, 3alpha-HSD, 4-HPPD-L, 4EHP, 6-16, 6.8PL, 7B2.

Interactions 9

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-429 interacts with:

Interaction id Participant Synonyms
EBI-20564332 URS0000A77400_9606 EBI-17172839 URS0000A77400_9606 lncrn_malat1 human
URS000055BBE5_9606-4 P05067 P05067
URS000055BBE5_9606-0 P05067 P05067
URS000055BBE5_9606-1 P23443 P23443
URS000055BBE5_9606-5 P23443 P23443
URS000055BBE5_9606-6 Q07157 Q07157
URS000055BBE5_9606-2 Q07157 Q07157
URS000055BBE5_9606-3 Q16625 Q16625
URS000055BBE5_9606-7 Q16625 Q16625

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAAUACUGUCUGGUAAAACCGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 27 other species

    Publications New