Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nicotiana tabacum (common tobacco) nta-miR160c URS000055B49A_4097

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Nicotiana tabacum. Annotated by 1 database (miRBase). Described in 0 papers.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGCCUGGCUCCCUGUAUGCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 65 other species

    1. Aegilops tauschii ata-miR160a-5p
    2. Amborella trichopoda atr-miR160
    3. Ananas comosus microRNA 160a
    4. Aquilegia coerulea aqc-miR160b
    5. Arabidopsis lyrata aly-miR160b-5p
    6. Arabidopsis thaliana ath-miR160a-5p
    7. Asparagus officinalis aof-miR160c
    8. Brachypodium distachyon bdi-miR160a-5p
    9. Brassica napus bna-miR160a
    10. Brassica rapa (field mustard) bra-miR160a-5p
    11. Carica papaya (papaya) cpa-miR160c-5p
    12. Corchorus olitorius ahy-miR160-
    13. Cucumis melo cme-miR160c
    14. Cynara cardunculus cca-miR160b
    15. Eugenia uniflora eun-miR160-5p
    16. Fragaria vesca subsp. vesca fve-miR160a
    17. Glycine max (soybean) gma-miR160a-5p
    18. Helianthus annuus (common sunflower) sRNA HannXRQ_Chr14g0456935
    19. Hordeum vulgare microRNA160a
    20. Linum usitatissimum (flax) lus-miR160j
    21. Lolium arundinaceum far-miR160
    22. Malus domestica mdm-miR160c
    23. Manihot esculenta (cassava) mes-miR160a
    24. Medicago truncatula mtr-miR160b
    25. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR160b-5p
    26. Oryza sativa (rice) osa-miR160b-5p
    27. Pachycladon cheesemanii Pch-miR160a
    28. Physcomitrium patens ppt-miR160f
    29. Picea abies (Norway spruce) pab-miR160a
    30. Populus tomentosa Pto-miR160d
    31. Populus trichocarpa (black cottonwood) ptc-miR160c-5p
    32. Prunus persica ppe-miR160a
    33. Ricinus communis (castor bean) rco-miR160b
    34. Selaginella moellendorffii smo-miR160a
    35. Solanum lycopersicum (tomato) sly-miR160a
    36. Solanum tuberosum stu-miR160b
    37. Sorghum bicolor (sorghum) sbi-miR160c
    38. Theobroma cacao tcc-miR160b
    39. Triticum aestivum (bread wheat) tae-miR160
    40. Triticum turgidum ttu-miR160
    41. Vigna unguiculata (cowpea) vun-miR160
    42. Vitis vinifera (wine grape) vvi-miR160d
    43. Zea mays zma-miR160a-5p