Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1414 (LINC01414) URS000055A7F8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01414: LINC01414, a long intergenic non-protein coding RNA 1414 located at chromosome 8q12.3, has been studied in relation to chronic obstructive pulmonary disease (COPD) in the Chinese Han population [PMC8261955]. In this study, three single nucleotide polymorphisms (SNPs) in LINC01414 and LINC00824 were analyzed [PMC8261955]. The SNPs rs699467 and rs7815944 in LINC01414 were associated with a lower prevalence of COPD, while the SNP rs298207 in LINC01414 was associated with an increased risk of COPD [PMC8261955]. The study also revealed an additive effect between the SNPs rs6994670-GG and rs298207-AA in LINC01414, as well as the SNP rs7815944-GG in LINC00824, on COPD susceptibility [PMC8261955]. Specifically, the SNP rs699467 was found to be a protective factor for COPD occurrence under dominant and additive models [PMC8261955]. However, no statistically significant association was observed for the SNPs rs6994670 and rs298207 in LINC01414 [PMC8261955]. The prevalence of the G-allele frequencies of SNP rs6994670 in LINC01414 was lower in COPD patients compared to controls [PMC8261955]. The function of LINC01414 has not been reported yet [PMC8261955]. In conclusion, this study suggests that certain SNPs within LINC01414 and LINC00824 may play a role in COPD risk among the Chinese Han population. However, further research is needed to fully understand the mechanisms involved [PMC8261955].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAGAUGCUGGAGACUUUGUUGCAAGAAAGGAUGGCUUUAGGUCAUGUUGCUGAGGCCUGAUCUUAAAGAUCUAAUUGCUAUUGGAAGAGAAUCCUGUUUCCCAACUGGGCCUCCCCUCUGGAGAUGGAGCAAGGAAGACUGUCCAACUCUGCUCUGGGCACCCUGCUGAUGGAUGAGGUGUCAGGCCAGUCGUCAUGUGAGGACUGGUUUCCAAAUGAUGAGAAAACUGAGGCUCUGAGAGAUGACAUCAUAAAGCCUUGUAAGACCCAGUUGCUGUGCUCCACCUUCAUACCUUCGCCUAUGUUAGAACUUCUGAGAAGCUGAAGCAUCACAUAUAAAAAGCCAAGACCAUCCUCAAGGAGUUUAAUGAAUGUGGCAUCACAAGAAAAAUAUGCAUCAACAUUGAAAAGCAAAGCCUUCCAGCCAGUUCAAUGGUGGGAGUCUCCCCCUGCUCUUCCUGCACAAUCAUUUCCCAUUGAGGAAGAAUGUGAAAAUGACGCACAGGUGAGGGAGGCAUACUAUAAGACCGCUUCUUACCUUUCGUUUCCUGGAGCCAAUAUGAAUGAAGACCCAGAGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications